ID: 931116020

View in Genome Browser
Species Human (GRCh38)
Location 2:59167686-59167708
Sequence TTTACCAAGGCAGCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931116020_931116024 24 Left 931116020 2:59167686-59167708 CCTGCTTGGGCTGCCTTGGTAAA No data
Right 931116024 2:59167733-59167755 TTGAAACATCAGCTGCCCAAAGG No data
931116020_931116022 0 Left 931116020 2:59167686-59167708 CCTGCTTGGGCTGCCTTGGTAAA No data
Right 931116022 2:59167709-59167731 TATTTACCTTGAATTATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931116020 Original CRISPR TTTACCAAGGCAGCCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr