ID: 931118088

View in Genome Browser
Species Human (GRCh38)
Location 2:59186243-59186265
Sequence CACTTTTGACTACTAGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931118088_931118097 26 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118097 2:59186292-59186314 GGTTCTCAAAGTGTGGTCCTGGG No data
931118088_931118093 5 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118093 2:59186271-59186293 CTCAGGTTAGTTTATGCCACTGG No data
931118088_931118094 19 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118094 2:59186285-59186307 TGCCACTGGTTCTCAAAGTGTGG No data
931118088_931118096 25 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118096 2:59186291-59186313 TGGTTCTCAAAGTGTGGTCCTGG No data
931118088_931118098 27 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118098 2:59186293-59186315 GTTCTCAAAGTGTGGTCCTGGGG No data
931118088_931118099 28 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118099 2:59186294-59186316 TTCTCAAAGTGTGGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931118088 Original CRISPR CACTTTTGACTACTAGCGTG GGG (reversed) Intergenic