ID: 931118093

View in Genome Browser
Species Human (GRCh38)
Location 2:59186271-59186293
Sequence CTCAGGTTAGTTTATGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931118087_931118093 12 Left 931118087 2:59186236-59186258 CCATAATCCCCACGCTAGTAGTC No data
Right 931118093 2:59186271-59186293 CTCAGGTTAGTTTATGCCACTGG No data
931118088_931118093 5 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118093 2:59186271-59186293 CTCAGGTTAGTTTATGCCACTGG No data
931118091_931118093 3 Left 931118091 2:59186245-59186267 CCACGCTAGTAGTCAAAAGTGGT No data
Right 931118093 2:59186271-59186293 CTCAGGTTAGTTTATGCCACTGG No data
931118086_931118093 13 Left 931118086 2:59186235-59186257 CCCATAATCCCCACGCTAGTAGT No data
Right 931118093 2:59186271-59186293 CTCAGGTTAGTTTATGCCACTGG No data
931118089_931118093 4 Left 931118089 2:59186244-59186266 CCCACGCTAGTAGTCAAAAGTGG No data
Right 931118093 2:59186271-59186293 CTCAGGTTAGTTTATGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931118093 Original CRISPR CTCAGGTTAGTTTATGCCAC TGG Intergenic
No off target data available for this crispr