ID: 931118096

View in Genome Browser
Species Human (GRCh38)
Location 2:59186291-59186313
Sequence TGGTTCTCAAAGTGTGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1202
Summary {0: 15, 1: 79, 2: 164, 3: 312, 4: 632}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931118088_931118096 25 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118096 2:59186291-59186313 TGGTTCTCAAAGTGTGGTCCTGG 0: 15
1: 79
2: 164
3: 312
4: 632
931118089_931118096 24 Left 931118089 2:59186244-59186266 CCCACGCTAGTAGTCAAAAGTGG No data
Right 931118096 2:59186291-59186313 TGGTTCTCAAAGTGTGGTCCTGG 0: 15
1: 79
2: 164
3: 312
4: 632
931118091_931118096 23 Left 931118091 2:59186245-59186267 CCACGCTAGTAGTCAAAAGTGGT No data
Right 931118096 2:59186291-59186313 TGGTTCTCAAAGTGTGGTCCTGG 0: 15
1: 79
2: 164
3: 312
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931118096 Original CRISPR TGGTTCTCAAAGTGTGGTCC TGG Intergenic
900282589 1:1880670-1880692 TGGTTCTCAAAGTGTGATCGTGG - Intronic
900747024 1:4367462-4367484 CGGTGCTGAAAGTGTGGCCCAGG + Intergenic
901096546 1:6685238-6685260 TGGTTCTCAAAGTGTGGTCTGGG + Intronic
901685881 1:10943094-10943116 TGGTTCTCAAAGTAGCGTCCCGG - Intergenic
901926848 1:12571459-12571481 TGGTTCTCAAAGTGAGGTCCAGG + Intronic
901950731 1:12743861-12743883 CGGTTTGCAAAGTGTGGGCCAGG - Intergenic
902165050 1:14563415-14563437 TTATTCTCAAAATGTGGTCTAGG - Intergenic
902185985 1:14725875-14725897 TGCTACTCAAAGGGTGGTCCAGG - Intronic
902187567 1:14736662-14736684 TGTTTCTTAAAGTGTGGTCAGGG - Intronic
902533839 1:17107588-17107610 TGGTTCTCAAAGTGTGGTACTGG - Intronic
902778748 1:18691168-18691190 TGGTTCTTACTGTGTTGTCCAGG + Intronic
902951521 1:19886859-19886881 TGATTCTCAAAGTGTGTTCCCGG - Intronic
903295346 1:22339873-22339895 TGGTGCTCACAGTGTGGTGGGGG - Intergenic
903389245 1:22952896-22952918 TGCTACTCAAAGTGTGGTCTTGG - Intergenic
903488641 1:23710508-23710530 TGGTTCTCAAAGCTTGGTTCCGG - Intergenic
903643610 1:24876880-24876902 TGATTTTCGAAGTCTGGTCCGGG + Intergenic
903956654 1:27030818-27030840 TGGGTCTCACAGTGTTGCCCAGG + Intergenic
904107527 1:28098352-28098374 TAGTTCTCAAAGTATGGTCTGGG + Intergenic
904471998 1:30741777-30741799 TGGTTCCCCAAGTGTGGTCCTGG - Intronic
904544092 1:31254747-31254769 TGATTCTCAAAGTGGGGTCCTGG - Intergenic
904719560 1:32497883-32497905 TGATTCGTAAAGTGTGGTCTCGG + Intronic
904969424 1:34407444-34407466 AGGTTCTCACAGGGTGGGCCAGG + Intergenic
905009747 1:34739339-34739361 TGGTTCTCAAAGTGTAGTCCAGG + Intronic
905386577 1:37608528-37608550 TGCTCCTCAAAGTGTGGCCATGG - Intergenic
906076042 1:43052878-43052900 TGCTACTCAAAGTGTGGTCTTGG - Intergenic
906354804 1:45095315-45095337 GGGGTCTCAATGTGTTGTCCAGG + Intronic
906475202 1:46164858-46164880 GGGTTCTCACTGTGTGTTCCAGG + Intronic
906692987 1:47805007-47805029 TGGTTCTCAAACTAGGCTCCAGG - Intronic
906949774 1:50324814-50324836 CAATTCTCAAATTGTGGTCCAGG + Intergenic
907947882 1:59152240-59152262 GGGTTCTCAAAGTGTGATCCTGG - Intergenic
908247095 1:62236214-62236236 TGCTACTCAAAGTGTGGTTGTGG + Intergenic
908443292 1:64177156-64177178 TGGTACTCAAACTGTGGTCTGGG - Intronic
909307165 1:74096354-74096376 TGGTTCTCAAAGTGTAGTTCAGG - Intronic
909675132 1:78230971-78230993 CGGTTCTCAAAGTGTAATCGGGG + Intergenic
910199481 1:84684159-84684181 TAGTTGTCAACGTGTGGTCCTGG + Intronic
910432193 1:87169839-87169861 TGTTTTTCAAGGTGTGGTCCTGG + Intergenic
910456616 1:87404180-87404202 TATTTCTCAAAATGTGGTCTAGG - Intergenic
910524445 1:88161725-88161747 AGATTTTCAAAATGTGGTCCAGG + Intergenic
910766731 1:90789697-90789719 TGGTTCTCAAAGTGTGTTCCTGG + Intergenic
911243885 1:95495796-95495818 TAGTTTGCAAAGTATGGTCCAGG + Intergenic
911378281 1:97079015-97079037 TGGTTCATAAGGTGTTGTCCTGG + Exonic
911882466 1:103258460-103258482 TGTTTCTTAAAGTGTGGCCCGGG + Intergenic
912208921 1:107537499-107537521 TCATTCTCAAAGTGTAGTCCTGG + Intergenic
912253914 1:108039761-108039783 TAGTTCTCAAAATGTGACCCTGG + Intergenic
912311444 1:108625268-108625290 TGGATCTCAAGGTGTGGTCAGGG - Intronic
912324040 1:108740966-108740988 TGATTCTCTAAGTGTGGTCCTGG + Intronic
912516956 1:110222478-110222500 TGGTCCTCAAAGTATGGTCCTGG - Intronic
912916383 1:113818912-113818934 CAGTTCTCAAAGTGTGATTCAGG + Intronic
913042553 1:115041426-115041448 TGGGTATAGAAGTGTGGTCCAGG - Intergenic
913177550 1:116288759-116288781 TGGTTCTCAAAGTGTGGTCCAGG + Intergenic
914235332 1:145804905-145804927 TGTTTCTCAAACTGTGTGCCAGG - Intronic
914732205 1:150381466-150381488 CAGTTCTCAACGTGTGGTCTGGG - Intronic
914974110 1:152342435-152342457 TGGTTCTCAATATGTAGTCTTGG + Intergenic
915061743 1:153191710-153191732 TGGTTGTCAAAGTGTGGTGTGGG - Intergenic
915080847 1:153350839-153350861 TGGTTCTCAAAAAGTGGCCCAGG + Intergenic
915456763 1:156045546-156045568 CAGTTCTCAAAGTGTGGTCCTGG + Intronic
915501258 1:156319678-156319700 TGGGTCTCAATGTGTTGCCCAGG - Intronic
915741594 1:158122916-158122938 TGGTTCTCAATGTATGGTTCTGG - Intergenic
916552779 1:165864877-165864899 AGGTTCTCAATGTGTTGCCCAGG + Intronic
916795838 1:168166522-168166544 TGTTTCTCAAAGTGTGGTGCTGG - Intergenic
916922890 1:169487184-169487206 TGAGTCTCAAAGTGTGGTCGAGG + Intergenic
917314742 1:173712963-173712985 TGATTCTCAAAGTGTTGTCCTGG - Intergenic
917335530 1:173920923-173920945 TGCTTCCCAAAGCATGGTCCAGG - Intergenic
917451931 1:175154418-175154440 TATTTCTCAAGGTGTGGTTCAGG + Intergenic
917726424 1:177832039-177832061 TGGTTCTCTAAGTGTGGGCCAGG - Intergenic
917890112 1:179428501-179428523 TGGTTCTCAAAGTATGGCCCAGG + Intronic
917946029 1:179971928-179971950 CAGTTCTCAAAGTATGGTTCAGG - Intronic
918065466 1:181097978-181098000 TGCTTCTTAAAGTATGGTCCAGG + Intergenic
918165125 1:181937617-181937639 CAGTTCGCAAAGTGTGGTCCAGG + Intergenic
918296086 1:183158691-183158713 TGGTTCTCAAAGTGAAGCTCTGG + Intergenic
918419840 1:184352984-184353006 TGGTTCTCCAAGTGTGGTTCTGG - Intergenic
918468102 1:184842395-184842417 TGGTTCTCAAAGTGTGTTCCTGG - Intronic
919447723 1:197730042-197730064 TGGCTCTCAAAGTGTAGTCTAGG - Intronic
919811224 1:201410050-201410072 TGGTTCTCCAAGTGTGGTCCTGG - Intronic
920048262 1:203147532-203147554 TGCTACTCAAAGCGTGGTCAGGG + Intronic
920065365 1:203265823-203265845 TGGTTCTCAATATGTTGCCCAGG + Intronic
920222554 1:204414653-204414675 TGGTTCCCAAAGTATGGTCTGGG + Intergenic
920343631 1:205291916-205291938 TGGTTCTCCAAGTGTGGTCCAGG - Intergenic
920449610 1:206049543-206049565 CAGTTCTCAAAGTGTAGTCCAGG - Intronic
921273560 1:213493923-213493945 TGGTTCTTCAAGTGTTGTCCTGG + Intergenic
921578222 1:216863229-216863251 TGATTCTAAAAGTGTGGTCCTGG - Intronic
921803011 1:219423033-219423055 TGTTTCTCAAAGTATGGTCAGGG - Intergenic
922067991 1:222162698-222162720 TGGTTCTCAAAGTATGGTCCTGG + Intergenic
922242337 1:223763978-223764000 TACTACTCAAAGTGTGGTCTGGG + Intronic
922280515 1:224119055-224119077 TGGTCCTCAAAGTGTGGTCTGGG - Intronic
922609168 1:226911628-226911650 TGCTTCTCAAAGTGTGGTCCTGG + Intronic
922614608 1:226954407-226954429 GGGTTCTCAAAGTAAGTTCCTGG + Intronic
923251879 1:232185452-232185474 TGCTTCTCAAAGTGGGGCCATGG - Intergenic
923373467 1:233335990-233336012 AGGTTCTCAAAGTATAGTCTAGG - Intronic
924479976 1:244421012-244421034 TGATTCTCAAAATGTGGTGAGGG + Intronic
924809188 1:247386346-247386368 TAGTTCTCACTGTGTGGTCGGGG + Intergenic
924841465 1:247714047-247714069 TGCTTCTCAGTGTATGGTCCTGG - Intergenic
1062870288 10:896170-896192 TGGTTCTCAATGTGTGGTGTAGG + Intronic
1062883904 10:1001565-1001587 TGGCTTTCAAATTGTGGTCCTGG + Intronic
1063349804 10:5343693-5343715 TGGTTTTCATGGTGTGCTCCTGG + Intergenic
1063383164 10:5599216-5599238 TGGTTCTCAAAGTGTCACCGAGG + Intergenic
1063433443 10:6011340-6011362 TGGTTCTCAAAGTGTGTTCCTGG + Exonic
1063500884 10:6553203-6553225 TGGTTCTCAAAGTGTGGTCCAGG - Intronic
1064026943 10:11856476-11856498 TGGTTCTCAAGGAGTGGAGCTGG + Intronic
1064042248 10:11977383-11977405 TGGTTCCCAAAGTATGCTCCTGG + Intronic
1064250782 10:13704877-13704899 TGGGTCTCACAGTGTTGCCCAGG - Intronic
1064378244 10:14816404-14816426 TGCTACTCAAAGCGTGGTCCTGG + Intergenic
1064412881 10:15122988-15123010 CAGTTCTCAAAGTGTGGCCCAGG - Intronic
1064741036 10:18434997-18435019 CAGTTCTCAAAGTGTGGCTCAGG - Intronic
1064933198 10:20650285-20650307 TGTTTCTCAAAGTATGTTCCAGG - Intergenic
1065087520 10:22194389-22194411 TGGTTCCCAAAGTGTGATCCAGG + Intergenic
1065217210 10:23460589-23460611 CAGTTCTCAAAGTGTGGTCCTGG - Intergenic
1065395602 10:25233641-25233663 TCATTTTCAAAGTGTGGTCCTGG + Intronic
1065399032 10:25275212-25275234 TGTTTTTAAAAGTGTGGTCCAGG + Intronic
1065458459 10:25932495-25932517 TGGTTCTCAGAGTGTGGTCTAGG - Intergenic
1065532570 10:26687488-26687510 TGGCTGTAAAAGTGTGGTTCTGG - Intergenic
1065880108 10:30030487-30030509 TATTTCTCAAGGTGTGGTCTTGG + Intronic
1065880146 10:30030759-30030781 TGATTCTCAAAGTAAGGCCCTGG - Intronic
1066223406 10:33357956-33357978 TGGTTCTCAAAGCATGGTCATGG + Intergenic
1066455029 10:35565262-35565284 TGGTTCTCAGAGTGTGGGCCCGG + Intronic
1066549228 10:36537031-36537053 GGGTTCTCAATGTGTTGCCCAGG + Intergenic
1066689782 10:38014700-38014722 TGTTTCACCAAGTGTGGTACTGG - Intronic
1067706991 10:48613704-48613726 AGGTTCTCATAGTTTGGTCCTGG - Intronic
1067756173 10:49007543-49007565 TAGTTTGCAAAGTGTGTTCCTGG - Intergenic
1067757326 10:49015012-49015034 TGTCACTCAAAGTGTGGTTCAGG + Exonic
1068034310 10:51740722-51740744 CAGTTCTCAAAGTGTGGTCCAGG - Intronic
1068047276 10:51902936-51902958 GAGTTCTCAAAATGTGGTCTGGG - Intronic
1068249133 10:54413309-54413331 TATTTCTCAAAGTGAAGTCCAGG + Intronic
1068561692 10:58521920-58521942 TGTTTCTCAAAGTGTGATCCTGG - Intronic
1068742944 10:60495289-60495311 TACTACTCAAAATGTGGTCCAGG + Intronic
1068811036 10:61256521-61256543 TGGTACTCAAACTGTCTTCCTGG + Intergenic
1068865537 10:61891284-61891306 TAGTTCTCAAAGTATGGTCTGGG + Intergenic
1068968934 10:62943059-62943081 TGGTTCTCTAGGTGTGGATCAGG + Intergenic
1068974220 10:62990802-62990824 TGGTTCTCAAAATGCAGTTCTGG - Intergenic
1069256443 10:66336803-66336825 TGCTTCTCAAAGAGTGGTCCAGG + Intronic
1069559162 10:69417448-69417470 TGGTTCTCAAAGTGAAGTGCTGG - Intergenic
1069653407 10:70068804-70068826 TGGTTCCCAAACTGTGCACCAGG - Intronic
1069888908 10:71640886-71640908 TGGTTCTCCAAGTGTGGTCCTGG - Intronic
1069952098 10:72026102-72026124 TGGTTCTCAAAGTTGGACCCGGG - Intergenic
1070042573 10:72796078-72796100 TGGTTCTGAGAGTATGGACCTGG - Intronic
1070071917 10:73098002-73098024 TGGTTCTGAAAGCGTAGTCAGGG + Intergenic
1070178144 10:73990020-73990042 TGGCTTTCAAAGTGTGGTCCAGG + Intergenic
1070324164 10:75376997-75377019 GTGTTCTCAAAGTGTGGTTCTGG + Intergenic
1070588741 10:77786537-77786559 TGGGTCTCACTGTGTTGTCCAGG - Intergenic
1070625299 10:78046858-78046880 CGATTCTCCAGGTGTGGTCCTGG + Intronic
1070724067 10:78776125-78776147 TGCTCCTCAAAGTGTGGTCCAGG - Intergenic
1070993841 10:80757437-80757459 TGGTTCTCAAAGTTTCGGCTGGG - Intergenic
1071146978 10:82586998-82587020 TGTTTCTCAAAATGTGACCCAGG + Intronic
1071445562 10:85743112-85743134 TGGTTCTCAATGGGTGGTGGGGG - Intronic
1071481041 10:86065176-86065198 TGGTTCTCCAAGTGTGCTCCTGG + Intronic
1071785794 10:88898388-88898410 TGGCTCTCAAAATGTGGTCCAGG - Intronic
1071865995 10:89732312-89732334 GGGTTCTCACTGTGTGGCCCAGG + Intronic
1072286069 10:93916669-93916691 TTTTTCCCTAAGTGTGGTCCAGG - Intronic
1072793028 10:98332611-98332633 TGGTTCTTACAGTGTGGCCTGGG + Intergenic
1072802730 10:98404734-98404756 TGGTTCTCAAAGTTATGTTCTGG + Intronic
1072908976 10:99483312-99483334 TTGTTCTCAAAGTGTGATTGGGG - Intergenic
1072927676 10:99630534-99630556 TATTTTTCAAAATGTGGTCCAGG - Intergenic
1073045724 10:100637161-100637183 TAGTTCTCAAAGCATGGTCCTGG + Intergenic
1073133375 10:101205282-101205304 TGCAACTCAGAGTGTGGTCCTGG - Intergenic
1073168162 10:101476876-101476898 TGGTTCTCGAAGAGTGTTCCTGG + Intronic
1073196806 10:101697868-101697890 GGGTTTTCACAGTGTTGTCCAGG - Intergenic
1073635557 10:105194804-105194826 TTGTTCTCAAAATACGGTCCTGG + Intronic
1074342092 10:112641990-112642012 TGGTGCTCAAAGAGTGGTCTGGG - Intronic
1074931724 10:118133063-118133085 CGGTCCTTAAAGTGTGGTCGTGG + Intergenic
1075260451 10:120958837-120958859 TGGTTCTCAAAGTGTGGCTCTGG + Intergenic
1075745727 10:124725982-124726004 TGGTTCTCCAAGCGTGGACCCGG + Intronic
1075848442 10:125566423-125566445 TCCTTTTTAAAGTGTGGTCCAGG + Intergenic
1076339299 10:129732057-129732079 AGATTCTCAAAATGTGGTCTAGG - Intronic
1076565417 10:131395311-131395333 TGGCTCTCAAAGTGTCTTCCAGG + Intergenic
1076946943 10:133658086-133658108 TGGTTATCAAAGGGTGGAGCTGG + Intergenic
1077448556 11:2618234-2618256 TTGTTCTTACAGTGTGGCCCCGG - Intronic
1078193943 11:9119202-9119224 TAGCTCTCAAAGTGTTGTCCCGG + Intronic
1079140309 11:17804412-17804434 TGGTTCCCAAACTATGGTCTGGG - Intronic
1079291509 11:19192229-19192251 TGGTTCTCATAGTGTGGTCCTGG - Intronic
1079306756 11:19330126-19330148 TGGCTCTCAAAGGGGAGTCCTGG - Intergenic
1079403070 11:20121903-20121925 TGCCACTCAATGTGTGGTCCAGG - Intergenic
1079547004 11:21644394-21644416 TAGTGTGCAAAGTGTGGTCCTGG + Intergenic
1080040043 11:27750087-27750109 GGGTTCTCAGAGTGTGACCCTGG + Intergenic
1080059835 11:27945620-27945642 TCTTTCTCAAAGTATGGTCAGGG + Intergenic
1080553346 11:33393430-33393452 TGGTTCTCAAAAGGTAATCCCGG + Intergenic
1080644619 11:34179376-34179398 CAGTCCTCAAAGTGTGGTCCAGG - Intronic
1081040170 11:38200481-38200503 TGCTTCTCAAATTGTAGTCCAGG + Intergenic
1081293051 11:41350173-41350195 TGGTTCTCAAAGTGTGTTCTGGG - Intronic
1081330626 11:41795633-41795655 TGGTTCTCACTTTGTGGCCCAGG + Intergenic
1081381962 11:42427730-42427752 TGGTTCTCGACCTGTGGTTCAGG - Intergenic
1081613171 11:44575598-44575620 TGGTACCCAAAGTGTGGTCCAGG - Intronic
1081815928 11:45941569-45941591 CAGTTCTCAAAGTGTAGTCTGGG - Intronic
1081837778 11:46171443-46171465 CGCTACTCAAAGTATGGTCCTGG + Intergenic
1082090323 11:48083814-48083836 TGGTTCTCAAAGAGTGGTCCTGG + Intronic
1082096201 11:48131778-48131800 TGGTTTTCAAATTGTGGTCCAGG + Intronic
1082181698 11:49127780-49127802 AGATTCTCAAAGTATGGTTCAGG - Intergenic
1083114662 11:60448724-60448746 TGGTTCTCAAAGTGTGGTCTCGG - Intronic
1083204906 11:61142750-61142772 TGGCTCTCAAAGTGTGTTTCAGG - Intronic
1083302735 11:61747378-61747400 TGCAACTCAAAGTGTGGCCCCGG - Intergenic
1083336380 11:61924073-61924095 GTGTTCTCAAAGTGCTGTCCTGG - Intergenic
1083468821 11:62868111-62868133 GGGGTTTCACAGTGTGGTCCAGG + Intronic
1083552112 11:63597872-63597894 TGGTTTTCAAGGTCTGCTCCTGG - Intronic
1084134038 11:67161672-67161694 TGGTTCTCAACATGTGGTCTGGG + Intronic
1084709766 11:70836644-70836666 TGGTTCTTTCTGTGTGGTCCTGG - Intronic
1085306906 11:75491563-75491585 TGCTACTCAAATTGTGGTCCAGG - Intronic
1085632423 11:78129548-78129570 CAGTTCTCAAAGTGTGATTCAGG + Intronic
1085719963 11:78903846-78903868 TGGTTTTTAAAGTGTGGCCAGGG + Intronic
1085816656 11:79744351-79744373 TGGTTCTCAAAGTGTGTTCCAGG + Intergenic
1085957380 11:81415624-81415646 TGCTTCTCAAAAGGTGGTTCTGG - Intergenic
1086361111 11:86060629-86060651 TGGTTCTTAAGGTGTGGTCTGGG - Intronic
1086576139 11:88340937-88340959 TGGTTCTCAAAGTGTAGCCTAGG + Intergenic
1086683798 11:89707061-89707083 AGGTTCACAAAGTATGGTTCAGG + Intergenic
1086943231 11:92819486-92819508 TGATATTCAAAGTGTGGTTCTGG - Intronic
1087042354 11:93814090-93814112 TTCTACTCAAGGTGTGGTCCTGG - Exonic
1087813642 11:102634785-102634807 TGGTTCACAAAATGTGGTCCAGG + Intergenic
1088158816 11:106842863-106842885 TGCTACTCAAAGTGTGGTCCAGG - Intronic
1089279328 11:117361927-117361949 TGGATCTCAAAGCGTGAGCCTGG + Exonic
1089348125 11:117804737-117804759 TGGGTCTCCATGTGTTGTCCAGG - Intronic
1089486667 11:118851780-118851802 GGGTCCCCAAAGTGTGGTCTGGG - Intergenic
1089538711 11:119176535-119176557 TGGTTAACCAAGTGTGGTGCCGG + Intronic
1089562056 11:119348269-119348291 CAGTTCTCAAAGTGGGGCCCGGG + Intergenic
1089904174 11:122021131-122021153 TAGTTCTCAAAGTGTGGAGTGGG - Intergenic
1090019372 11:123113634-123113656 AGGTTCTCAAAGTCTGGTGGTGG + Intronic
1090144225 11:124302437-124302459 TGTTTCTCAAATTGTGGACAAGG - Intergenic
1090487618 11:127128013-127128035 TGGTTCTCAAAATGTGGTCCAGG + Intergenic
1090732805 11:129586421-129586443 TGCTGCTTAAAGTGTGGTTCAGG + Intergenic
1090849158 11:130556534-130556556 TGTTTCTCAAAGTGTGTTCCAGG + Intergenic
1090966472 11:131601644-131601666 TGGTTTTCATACTGTGCTCCAGG - Intronic
1091013244 11:132025422-132025444 TGCTTCTCAAAATGTGGTCCTGG + Intronic
1091806264 12:3358385-3358407 TAGTTCCCAAAGTGAGGTCTGGG - Intergenic
1092091539 12:5807863-5807885 TGGTTCTCAAAATGTGGTCTGGG + Intronic
1092127027 12:6081646-6081668 TGGTTCTTAAGGTGAGGTCCAGG + Intronic
1092206703 12:6618952-6618974 TGGTTCTCAAAGTGTGATCCAGG + Exonic
1092268626 12:7003491-7003513 TGGGTCTCACTGTGTTGTCCAGG + Intronic
1092362048 12:7845425-7845447 TGCTACTCAAATTGTGGTCCGGG + Intronic
1092482522 12:8873148-8873170 TGCTTCTCAAAGTGTGGTCGAGG - Intronic
1092764220 12:11838285-11838307 TGGTTCTCAAAATGTGATCTTGG - Intronic
1093546679 12:20356930-20356952 TAGTTCTTGAAGTGTGATCCTGG + Intergenic
1093782517 12:23153429-23153451 AGGGTCTCACAGTGTTGTCCGGG + Intergenic
1093958282 12:25247612-25247634 CAGTTCTCAAAATGTGGTCTAGG + Intronic
1094249398 12:28341643-28341665 TAGTTTTCAAAGTGTGGTCAAGG - Intronic
1094501938 12:31029400-31029422 AGGTTCCCAAAGTATGGTCCTGG + Intergenic
1094754479 12:33450713-33450735 TGGTTCTCAAAGTGTGGTCCCGG - Intergenic
1095088941 12:38086481-38086503 TGGTTATCAAAGGGTGGAGCTGG - Intergenic
1095113540 12:38326273-38326295 TGGTTCTTCCAGTGTGGCCCAGG + Exonic
1095326541 12:40901340-40901362 TGTTTTCCAAAATGTGGTCCAGG + Intronic
1096731041 12:53612605-53612627 CAGTTCTCAAAGTGGGCTCCAGG + Intronic
1096752774 12:53772786-53772808 TGGTTCTCAAACTATGGAACAGG - Intergenic
1097004562 12:55906592-55906614 CGATTCTCAAAGTGTGGTTCAGG - Intronic
1097160082 12:57039885-57039907 TGGTTCCTAAAGGGTAGTCCTGG - Intronic
1097307867 12:58089062-58089084 TGCTACTCAAAGTGTGACCCTGG - Intergenic
1097677850 12:62622356-62622378 TGGTTCTCAAAACGTGGACCAGG + Intergenic
1098168541 12:67721994-67722016 CGCTACTCAAAGTGTGGTCTGGG - Intergenic
1098284175 12:68891588-68891610 AGGTTCTCAAAGTGTGGTCATGG + Intronic
1098361237 12:69656291-69656313 TGATTCTCAAAGTGTAGTCTGGG - Intronic
1098383637 12:69895896-69895918 TGGTTTTCAAAGTGTGGTTCCGG + Intronic
1099144450 12:79022348-79022370 TGGCTCTCAAAGTATGATCTGGG + Intronic
1100040287 12:90309186-90309208 TAGTTATCACAGTGTGGTCCAGG + Intergenic
1100563021 12:95768156-95768178 TGTTTCTCCAAGTGTGGTCTGGG + Intronic
1100902215 12:99254266-99254288 TAGTTATCAAAGTGTAGTCCAGG + Intronic
1100916830 12:99433491-99433513 CAGTTCTCAATGTGTGGTTCAGG - Intronic
1101061730 12:100979438-100979460 TGGTTCTCAACATGTGGTCCAGG - Intronic
1101123349 12:101606423-101606445 TGGTTCTCAAAGTACAGTCTGGG - Intronic
1101369304 12:104110962-104110984 TTGTTGTCAAAGTGTGGTTCAGG + Intergenic
1101457985 12:104857232-104857254 TGGTTCTCAAAGTGTGGTCTAGG + Intronic
1101464811 12:104937677-104937699 TTGTTATCAAAGTGTGGTCTTGG + Intronic
1102889172 12:116544760-116544782 TGTTTCACAAAGTGTGCTCTGGG - Intergenic
1102928414 12:116844009-116844031 TGGTTCCCAAAGTGTGGCCAGGG + Intronic
1103186417 12:118961591-118961613 TGCTCCTCAAAGTGTGGTTTGGG + Intergenic
1103238070 12:119390769-119390791 TGCTACTCAAAGTGTGGCTCGGG - Intronic
1103370870 12:120418313-120418335 TGTTTCTCAAAGTGTGCCCCAGG - Intergenic
1103392130 12:120582085-120582107 TGGTTCTCAAAGTGCCGTCTGGG + Intergenic
1103702359 12:122854564-122854586 TGGTTCTCAAAGTGCGGTCGAGG - Intronic
1103886974 12:124209580-124209602 TGATTCTCAAAGTATGGTCAAGG + Intronic
1104023947 12:125012682-125012704 TGGTTCTCATAGTGTGGAACTGG + Intronic
1104027593 12:125039751-125039773 TAGTTCTCAAAGTGTGGTCTGGG + Intergenic
1104969255 12:132523818-132523840 CGGTTCTCAACGCGGGGTCCCGG - Intronic
1105322028 13:19335116-19335138 TGCTAGTCAGAGTGTGGTCCTGG + Intergenic
1105496445 13:20934886-20934908 AGGTTCTCAAACTGTGTGCCAGG - Intergenic
1106286239 13:28320384-28320406 TGGCTCTCGAAGTATGGTCCTGG + Intronic
1106788945 13:33135202-33135224 TGCTACTCAGAGTGTGGTCAGGG + Intronic
1106959213 13:34977996-34978018 TGGGTCTCACTGTGTGGCCCAGG + Intronic
1107123818 13:36822583-36822605 TGGGTCTCACAGTGTTGCCCAGG + Intronic
1107347258 13:39475090-39475112 TGGTTCTCTGAGGGTGGTCCTGG - Intronic
1107395032 13:40006548-40006570 TGGTTCCCAAAGAGTGGTATGGG - Intergenic
1107799965 13:44096793-44096815 TAGTTCTCAATGTGTGGTTTGGG + Intergenic
1108003314 13:45924183-45924205 TAGTTCTCAGAGTGTGGTCCCGG + Intergenic
1108148752 13:47508463-47508485 TGGAATTCAAAGTGTGGTCCTGG + Intergenic
1108181740 13:47846795-47846817 TATTGCTCAAAGTGTGGTCCAGG + Intergenic
1108201293 13:48046487-48046509 TGGTTGTCAAAGTGTGGTCTGGG + Exonic
1108225119 13:48281387-48281409 TGGTTCTCAAAGTATAGTCCTGG - Intergenic
1108314941 13:49227707-49227729 TGGTTCTCAAAGTGTGATCCTGG - Intergenic
1108382688 13:49869251-49869273 TGGATCTCAAAGTGTGTCCCTGG - Intergenic
1108510553 13:51151929-51151951 TGATCCTCAAAGTATGGTCCAGG + Intergenic
1108520031 13:51238245-51238267 TGCTGCTCAGAGTGTGGTCCAGG + Intronic
1108680418 13:52775454-52775476 TGGTTGTTAAAGTGTGGTCAGGG - Intergenic
1108695857 13:52901744-52901766 TGGTTCTCAAAGTGTGGTTCTGG + Intergenic
1109465351 13:62725212-62725234 TGATTCTCAAAGTGTAATCCAGG + Intergenic
1110172973 13:72524371-72524393 AAGCTCTCAAAGGGTGGTCCTGG - Intergenic
1110563440 13:76934402-76934424 TGGTTCTCAGCGTGTCGTCTTGG + Intergenic
1110694332 13:78470478-78470500 TGGTTCTCAAAGTGTGGTTGGGG - Intergenic
1111646465 13:91038072-91038094 TGATTCTAAGAGTGTGGTTCCGG + Intergenic
1111895605 13:94137946-94137968 TATTTCTCAAAATGTTGTCCAGG - Intronic
1112062253 13:95752777-95752799 TGATTCTCAAAGTGTGACCTAGG - Intronic
1112364973 13:98748805-98748827 TGGTTCTCAAAGCGTGGGCCTGG + Intronic
1112365681 13:98752976-98752998 TGGTTTCCAAAGTGTCGTTCTGG - Intergenic
1112374133 13:98823333-98823355 TGGTTCTCTAAACATGGTCCTGG - Intronic
1112389143 13:98966878-98966900 TGGTTCTCTAAGTTTGGTCCTGG + Intronic
1112437714 13:99403534-99403556 TGGTTCTCAGACTGTGGTCTGGG - Intergenic
1112747239 13:102540549-102540571 TGATGCTTAAAGTGTGGTCCTGG + Intergenic
1112803462 13:103136989-103137011 TGTTTCTCAGTGTGTGGGCCTGG + Intergenic
1113069306 13:106404677-106404699 TGATTCTAAAAGTGTGGCCCCGG + Intergenic
1113100742 13:106714646-106714668 TGTTTGTCAAACTGTGTTCCAGG - Intergenic
1113311097 13:109134005-109134027 TGTTCCTTAAAGTGTGGTCTGGG - Intronic
1115366730 14:32566029-32566051 AGGTTCTCACAGTATGGTCTCGG + Intronic
1115402329 14:32976181-32976203 TGCTTCTTAAAGTGGAGTCCAGG - Intronic
1115520352 14:34227430-34227452 TGGTTTTCAAAGTGTGATTCTGG - Intronic
1115830156 14:37328681-37328703 TGCTCCTCAAAGTGTGATCCAGG - Intronic
1115888584 14:38001842-38001864 TGTTTCTCAAAGTGTGGTCCTGG - Intronic
1117229752 14:53704224-53704246 TGGTTCTCAAAATGTGATCTGGG + Intergenic
1117736019 14:58769377-58769399 TGCTGCTCAAAGTGTGGTCCAGG + Intergenic
1117803327 14:59465961-59465983 TGCTTCTGTAAGTGTGGTCCTGG - Intronic
1117844389 14:59895694-59895716 TGTCTCTCAAAGTATGGTCTGGG + Intergenic
1118159189 14:63271933-63271955 TGGCTCTCAAAGTATGGTGTAGG - Intronic
1118221757 14:63860925-63860947 TGGTTCTCAAAGTAGGGTCCAGG + Intronic
1118348356 14:64956051-64956073 CTGTTCTCAAAGTGTGTCCCTGG + Intronic
1118970892 14:70636687-70636709 TGCTTCTCAAAATGTGGTCCAGG + Intergenic
1119044223 14:71303488-71303510 GGGATCTCACAGTGTTGTCCAGG - Intergenic
1119381689 14:74233340-74233362 AGGGGCTCACAGTGTGGTCCAGG - Intergenic
1119483091 14:74971770-74971792 TGCTGCTCAAACAGTGGTCCGGG + Intergenic
1119819098 14:77598629-77598651 TGTTTATATAAGTGTGGTCCAGG + Intronic
1120096028 14:80388643-80388665 TGGTTCTCAGAGTCTGGGCCTGG + Intergenic
1120203610 14:81564514-81564536 GGGTTCTCACTGTGTGGCCCAGG - Intergenic
1120847409 14:89138708-89138730 TGCTACTCAAAGTGTGGTCCAGG - Intronic
1121214539 14:92237201-92237223 TACTACTCTAAGTGTGGTCCTGG - Intergenic
1121230579 14:92354745-92354767 TGGTACTCCAAGTGTGCTCTGGG - Intronic
1121585516 14:95060534-95060556 TGCTACTCAAAGTGTGGTCTAGG - Intergenic
1121641034 14:95485039-95485061 TGGTTCTCAAAGTGAGGTCCTGG - Intergenic
1122445941 14:101768749-101768771 GGGTTCTCAAAGTGTGGTCTGGG - Intronic
1202921015 14_KI270723v1_random:30635-30657 TGGTTATCAAAGGGTGGAGCTGG + Intergenic
1202923899 14_KI270724v1_random:6939-6961 TGGTTATCAAAGGGTGGAGCTGG - Intergenic
1124625238 15:31304024-31304046 TAGTTCTCAAACTGTGTTCTGGG - Intergenic
1125068605 15:35524318-35524340 TACTACTCAAAGTGTGGTCTAGG - Intronic
1125368765 15:38947652-38947674 TGGTTCTCAACCTGAGGTCACGG - Intergenic
1125608279 15:40954515-40954537 TCCTCCTCAAAGTGTGGTCCAGG - Intronic
1125677513 15:41510808-41510830 TGGTTCTCAAAGTGTGGTCCAGG - Intronic
1125775557 15:42209300-42209322 TGCTACTCAAAATGTGATCCAGG - Intergenic
1125877604 15:43163886-43163908 TGTTTCTCAAAGTAAGATCCTGG - Intronic
1125961044 15:43830210-43830232 TGGTTATCAAAGTGCAGTCCTGG - Intronic
1126391064 15:48152901-48152923 TAATTCACAAAGTATGGTCCAGG + Intronic
1126550657 15:49925516-49925538 TGATTCTAAATGTGTGGTCCAGG - Intronic
1126597134 15:50394262-50394284 TGGTTTTCAAATTGTGGTCTGGG + Intergenic
1126639953 15:50814257-50814279 TGGTTCTCAATGGGTGGTCCAGG - Intergenic
1127206501 15:56725652-56725674 TAGTTCTCTAAATGTGGTCTTGG - Intronic
1127383288 15:58447784-58447806 CGCTTCTCAAAGTGTAGTTCAGG - Intronic
1127605148 15:60579311-60579333 TGGTCTTCAATGTGTGATCCAGG - Intronic
1127668420 15:61171471-61171493 TGGTTCTTAGGGTGTGGGCCTGG - Intronic
1127792929 15:62414426-62414448 GGCTCCTCAAAGTGTAGTCCAGG + Intronic
1127793895 15:62422261-62422283 TGTTTCTCAAAGTGCAGTCCAGG + Intronic
1127846315 15:62874635-62874657 TGGCTCTCAAAGTGTGGTCCAGG - Intergenic
1127919659 15:63483540-63483562 CAGTCCTCAAAGTGTGATCCAGG - Intergenic
1127922992 15:63508203-63508225 GGGTTCTCAAAGTGTGGTCCTGG - Intronic
1128203607 15:65830964-65830986 TGTTTCTCAAATTGGGGTTCAGG + Intronic
1128378221 15:67092411-67092433 CAGTTCTCAAAGTGTGGCCCTGG + Intronic
1128393364 15:67198367-67198389 CGGTTCTCAAAGTGGGTCCCAGG + Intergenic
1128409404 15:67379500-67379522 TGATTCTCAAATTGTGATCTGGG - Intronic
1128526063 15:68413196-68413218 CAGTTCTCAAACTGTGTTCCAGG - Intronic
1128845806 15:70893121-70893143 GGGTACTCAAAGTCTTGTCCAGG + Intronic
1129306647 15:74669662-74669684 TGCTCCTCACACTGTGGTCCTGG - Intronic
1129353709 15:74973360-74973382 TGGTCCTTCAAGTGTGATCCAGG + Intronic
1129509262 15:76108565-76108587 TGCTTTTCAAAGTGCGGTCCCGG - Intronic
1129572474 15:76703181-76703203 TGTTTATTAAAGTGTGCTCCAGG + Intronic
1130096156 15:80857697-80857719 TGCTACTCAGAGTGTGGTCAAGG - Intronic
1130654308 15:85781443-85781465 ATGTTCTCAAAGTGTGGTCTGGG - Intronic
1130905730 15:88239857-88239879 TCACTCTCAAAGTGTGGTCCTGG + Intronic
1130975863 15:88773743-88773765 TGGTTCTCAAAGTGTGATCCAGG + Intergenic
1131303820 15:91223846-91223868 TGTTTCTCAAAGTGCAGTCCTGG + Intronic
1131348886 15:91678481-91678503 TGGTTCTCAAAGTGGGTCCCTGG + Intergenic
1131764946 15:95665561-95665583 TGGTATTCAAGCTGTGGTCCCGG - Intergenic
1131815037 15:96213274-96213296 TGTGCCTCAAAGTATGGTCCTGG + Intergenic
1132085871 15:98907873-98907895 TGGTTCTCCACGTGTGGTCCAGG + Intronic
1132730836 16:1361130-1361152 GGGTTCTCACAGTGTTGCCCAGG + Intronic
1133422904 16:5662554-5662576 TAATTCTCAAAGTGTGGTCCAGG - Intergenic
1133823736 16:9259369-9259391 CGATTTTCAAAGTGTGGTCCTGG + Intergenic
1133983994 16:10654074-10654096 AGGTTCTCACACTGTTGTCCAGG + Intronic
1134343405 16:13366523-13366545 TGCTACTCACAGTGTGGTCTAGG - Intergenic
1134438332 16:14282098-14282120 TGCTTCCCAAAGTGAGGCCCTGG + Intergenic
1134750384 16:16620199-16620221 AGCTACTCAAAATGTGGTCCAGG - Intergenic
1134820644 16:17244168-17244190 GGCTTCTCAAAGTGTAGTTCTGG + Intronic
1134823783 16:17267986-17268008 TGGTTCTTAAAGTGTGGTCTGGG + Intronic
1134995072 16:18733393-18733415 AGCTACTCAAAATGTGGTCCAGG + Intergenic
1135139846 16:19912033-19912055 TGTTTCTCAGAGCGTGGTGCAGG - Intergenic
1135147251 16:19973368-19973390 TGATCCTCTAAATGTGGTCCTGG - Intergenic
1135198008 16:20410412-20410434 TGCTACTCAAAGTGTGATCTTGG - Intronic
1135249305 16:20887444-20887466 TGTTTCTCAAAGTGTGGCTTTGG - Intronic
1135466554 16:22691265-22691287 TGCTACTCAAAGTGTGGTCCTGG + Intergenic
1135504903 16:23027805-23027827 TGGTTTTCAAAGTGTGGTCCTGG + Intergenic
1136007797 16:27342972-27342994 TGGTTCTCAAAGTGTGGTCTGGG - Intronic
1136057384 16:27700559-27700581 TGCTGCTCACAGGGTGGTCCTGG + Intronic
1136543972 16:30945305-30945327 TGGTTCTTAAAGTGTGGTCGGGG + Intronic
1137272558 16:46911773-46911795 TGCTACCCCAAGTGTGGTCCTGG - Intronic
1137279124 16:46960227-46960249 TGATTCTCTAAGTGTGGTTCTGG + Intronic
1137601834 16:49761501-49761523 TGCTACTCAGAGCGTGGTCCTGG - Intronic
1137699175 16:50484099-50484121 TGGTTTTCAAAGTGTGATCCAGG - Intergenic
1137702944 16:50510336-50510358 TAATCCTCAAAGTGTGGTCCTGG - Intergenic
1137930221 16:52580106-52580128 TGCTACTCAAAGTGTGGTCCAGG + Intergenic
1138473879 16:57259259-57259281 TACTCCTCCAAGTGTGGTCCAGG + Intronic
1139157394 16:64460223-64460245 TATTTCTCAAAGTGTGATTCTGG + Intergenic
1139278734 16:65751427-65751449 TGGTTCTGAAAATCTGGGCCAGG + Intergenic
1139401373 16:66684527-66684549 TGGTTTTCAGAGTGGGGTCCTGG - Intronic
1139418595 16:66834050-66834072 TGGTTTTCAAAGTGTGGTCCTGG + Intronic
1140035065 16:71365496-71365518 TGGTTTTCAAATTTTGGTCTAGG - Intronic
1140054567 16:71514734-71514756 TAGTTTTCAAAGTGTGGTCCAGG - Intronic
1140241900 16:73209878-73209900 TGGCTCTCAACGTGTGGTCTGGG - Intergenic
1140303549 16:73781388-73781410 TGGTTCCCAAAGTGTGATGCAGG - Intergenic
1140564374 16:76023971-76023993 TGGCTCTCAAAGTTTGGTGCTGG + Intergenic
1140828416 16:78728662-78728684 TGGTTGTCAAAGTGCAGTCAAGG - Intronic
1141055890 16:80813620-80813642 CAGTTCTCAAAGAGTGGTCCAGG - Intergenic
1141098255 16:81178204-81178226 AGTTTCTCAAAGTGAGGCCCTGG - Intergenic
1141262569 16:82467254-82467276 TGATTCTCAGAGTATGGTCCTGG - Intergenic
1141424783 16:83937784-83937806 TGGTTCCCAAAGTGTGTTCCAGG + Intronic
1141793168 16:86250295-86250317 TGTTTCTAGAAGTGTGTTCCAGG + Intergenic
1141956324 16:87374046-87374068 GGGTTCTCACAGTGTTGCCCGGG - Intronic
1143212361 17:5197932-5197954 TGGTTCTCAAAGAGTGGTCTGGG + Intergenic
1143226581 17:5309807-5309829 TGATTCTCAAAGTGTGATTGTGG + Intronic
1144170644 17:12656712-12656734 TGGTTCATAAAGTGTGATCTGGG - Intergenic
1144180897 17:12751837-12751859 TGGTTCTCAAAGTCAGGTCGGGG + Intronic
1144201757 17:12948372-12948394 TGATTCTAAAAGTGTAGGCCGGG + Intronic
1144322058 17:14135564-14135586 TGTTTCTCAAAGTGCAGTTCAGG - Intronic
1144394552 17:14831479-14831501 CAATTCTCAAAGTGTGGTCCTGG - Intergenic
1144406806 17:14959816-14959838 AGGTACTCAAAGTGTGGTCTGGG - Intergenic
1144814537 17:18024846-18024868 TGGTTCTCAAAGTGTGGCCCTGG + Intronic
1144838342 17:18170218-18170240 GGGTTCTCAAAGTGTGGTCGAGG - Intronic
1145217479 17:21062779-21062801 TGATTCTCAGAGCGTGGTGCTGG - Intergenic
1146211254 17:30945415-30945437 TGCTTCTCAACATGTGGTCCTGG + Intronic
1146274193 17:31504854-31504876 TGGTTTGCAAAGTGTGGTCCTGG + Intronic
1146392341 17:32434208-32434230 TGGTTCTCAAAGTATGGTCTGGG - Intergenic
1146422029 17:32695888-32695910 CAGTTCTCAAAGTGTGGTTGGGG + Intronic
1146763678 17:35499733-35499755 TACTTCTCAAAGTGGGGTCTGGG - Intronic
1146778160 17:35640743-35640765 TGGTTGTCAATGTGTGGTTCCGG - Intronic
1146918152 17:36691258-36691280 TGATTTCCAAAGTGTGTTCCCGG - Intergenic
1147195657 17:38764995-38765017 TAGTTCTCAAAGTGTGGTCTTGG - Intergenic
1147251224 17:39153587-39153609 TGGCTCTCAAAATGTGGTCCTGG - Intronic
1147402515 17:40189470-40189492 TGCTACTCAAAGTATGGTCCCGG + Intronic
1148141376 17:45331522-45331544 CTATTCTCAAAGTATGGTCCTGG - Intergenic
1148358273 17:46991042-46991064 TGGTTTTCAAATTATGTTCCTGG + Intronic
1148964628 17:51424288-51424310 TGGTTCTCAAAGCATGTTCTGGG + Intergenic
1149527507 17:57368042-57368064 TGGTACCCAAATTGTGGTTCGGG + Intronic
1149917931 17:60628840-60628862 TGGTTCTCAAAATGTGGTTTAGG - Intronic
1150031444 17:61740424-61740446 TTATTTTCAAAGTCTGGTCCTGG - Intronic
1150193880 17:63273760-63273782 TGGCTCTCACAGTGTGGTCCTGG + Intronic
1150245430 17:63671185-63671207 TGGTTCTCAAAGTGTGTTCTGGG + Intronic
1150552294 17:66221874-66221896 TGCTGCTCAAAATGTGGTCCAGG + Intronic
1151268617 17:72976307-72976329 TAGTTCTCAAAGTGTGTTTGGGG - Intronic
1151810689 17:76439353-76439375 TGGTCCTCAAAATATGGCCCAGG + Intronic
1151993150 17:77591585-77591607 GGCTTCTCAAAGTGTGGCTCAGG - Intergenic
1152056331 17:78030745-78030767 TGGTTCTCATAGAGAGGTGCTGG + Intronic
1152141297 17:78538389-78538411 CGATTCTCAAAATGTGGGCCAGG + Intronic
1152389227 17:79992858-79992880 TGGTTCCCAAAATGAGGTGCAGG - Intronic
1152900550 17:82938580-82938602 TGGTTCTCGAAGTGGGGTGCCGG + Intronic
1153334766 18:3911912-3911934 TGGTTATCAAAGTGGGTCCCTGG + Intronic
1153479637 18:5534357-5534379 TGTGTCTCAAAATGTGGTCCTGG + Intronic
1153490752 18:5645517-5645539 TGGTTTTCAAAATGTGGTCTTGG - Intergenic
1153502961 18:5767641-5767663 TGCCACTCAAAGTGTGGTCCAGG + Intergenic
1153947521 18:10030840-10030862 TGGTTCTCAAAGTGGGGTCCAGG - Intergenic
1155369830 18:25086887-25086909 TGGTTCTCAAAGGGTGGCCCAGG + Intronic
1155490671 18:26398455-26398477 TGGTTAACACAGTGTCGTCCTGG + Intergenic
1155509098 18:26559518-26559540 TGGTTCTCACAATGGGGTCCAGG - Intronic
1155512085 18:26588410-26588432 AAGTTCTCACTGTGTGGTCCAGG - Intronic
1155563845 18:27110815-27110837 TGGTTCTGAAAGTGTGGTTTTGG + Intronic
1155703196 18:28775319-28775341 GGATTATCAAAGTGTGGTGCTGG - Intergenic
1155912889 18:31525259-31525281 GGCTTCTCAAAGTGTGGGGCTGG - Intronic
1156096928 18:33544753-33544775 TGATTTTCAAAGTGAGGTCCTGG - Intergenic
1156775787 18:40787005-40787027 TATTTCTCCAAGTGTGGTCTGGG + Intergenic
1157376826 18:47175186-47175208 TGGTACACAACGTGAGGTCCTGG + Intronic
1157681633 18:49612053-49612075 TGCTTCTCAAAGTGTGGTCCAGG - Intergenic
1157877406 18:51286718-51286740 AGGGTCTCACTGTGTGGTCCAGG - Intergenic
1158021039 18:52841850-52841872 TGTTTCTGGAAGTGTGGTCCTGG + Intronic
1158627412 18:59083359-59083381 CGATTCTCAAAGTGTGATCTGGG - Intergenic
1158676442 18:59523758-59523780 TGGTTCACAAAGGGTGAGCCAGG + Intronic
1158688508 18:59638402-59638424 CGGTTCTTGAAGTGTGGTCCTGG + Intronic
1158800640 18:60904434-60904456 TGGTTCTCAAAACATGGTTCTGG - Intergenic
1158826643 18:61227644-61227666 TGCTTCTCAGAGTGTGTTCCAGG - Intergenic
1159372951 18:67552347-67552369 GGGTTCTCGGGGTGTGGTCCTGG - Intergenic
1159716988 18:71836637-71836659 TGGTTCTCAAAGTGTTGTGTGGG + Intergenic
1160049772 18:75421970-75421992 TGGTTCTCAAAGTGTAGTCCGGG - Intronic
1160828277 19:1090763-1090785 GGGTTCTCAAAGGGTGGCCCTGG - Intronic
1161132695 19:2600844-2600866 GAGTTCTCAAAGTGTGGTCCAGG - Intronic
1162193480 19:8965468-8965490 TGGTTTCCAAAGTGAGTTCCTGG + Exonic
1162361932 19:10225728-10225750 TGGGTCTCACTGTGTTGTCCAGG + Intronic
1163182411 19:15613995-15614017 AGTTACTCAAAGTGTGGTCCAGG - Intergenic
1163354180 19:16799041-16799063 CAGTTCCCAAAGTGTGTTCCAGG - Intronic
1164279915 19:23760127-23760149 TGGTTAACAAAGTGTGGAGCTGG + Intergenic
1164523275 19:28995087-28995109 TGGTTCTCCAAGTGTGGTCTTGG - Intergenic
1164563646 19:29310822-29310844 TGGGTCTCACTGTGTTGTCCAGG + Intergenic
1164655588 19:29918876-29918898 GGGTTCTCACTGTGTTGTCCAGG - Intergenic
1164743650 19:30595060-30595082 TAGGTCTCAAAGTGTGGCCAAGG + Intronic
1165310584 19:35027264-35027286 TGGTTCTCAAAGTGTGGTCTGGG - Intergenic
1165352824 19:35285602-35285624 AGGTTCTCAAAGTAAGATCCAGG + Intergenic
1165654895 19:37524674-37524696 AGCCTCTCACAGTGTGGTCCCGG + Intronic
1165734313 19:38166107-38166129 TGGCTCTCAAAGTGTGGTCCTGG - Intronic
1165886471 19:39082624-39082646 CAGTTCTCAAAATGTGGTCTGGG + Intergenic
1165984864 19:39759086-39759108 GGGGTCACAAAGTGTGATCCAGG + Intergenic
1166077081 19:40420006-40420028 TGGGTCTCACTGTGTTGTCCAGG - Intergenic
1166357387 19:42235229-42235251 TGGTTCTCAGAGTGTGGTCCGGG - Intronic
1166407005 19:42528620-42528642 TGATTCTCAAAGTGTGGTCTGGG - Intronic
1166548590 19:43649776-43649798 CGGTTCTTAAAGTGTGGCTCAGG + Intronic
1166663325 19:44661590-44661612 TGCTTCTCAAGGTGTGGCCATGG - Intronic
1166672463 19:44719088-44719110 TGGTTCCCAAAGTCTGGCCTTGG - Intergenic
1166855760 19:45782044-45782066 TGGGGCTCAGAGTGTGGACCTGG - Intronic
1166947405 19:46405513-46405535 CGGTTCTCAAAGTCAGGTTCTGG + Intergenic
1166959209 19:46487878-46487900 CGGTTCTCAAAATCAGGTCCTGG - Intronic
1166962039 19:46502925-46502947 GGGTTCTCAAAGTGTGGTCTGGG + Intronic
1167121226 19:47518197-47518219 GGTTTCTCAAACTGTGGTCCCGG - Intergenic
1167296081 19:48650673-48650695 GGGTTCTCATTGTGTTGTCCAGG - Intergenic
1167407968 19:49326452-49326474 TCATTCTCAAAGTGTGGCTCAGG - Intergenic
1167793962 19:51697133-51697155 TGATTCTCAAAGAGTGTTCCCGG - Intergenic
1168104187 19:54156611-54156633 TGGTTCTCAGCATGTGGTCCAGG - Intronic
1168675556 19:58275443-58275465 TAGTTCTTAAAGTGTGGGTCAGG - Intronic
925827737 2:7866486-7866508 TCGTTCTCCCAGTGTGGCCCTGG + Intergenic
926069340 2:9872911-9872933 TGGTTCTCAAAGTATACTCCTGG - Intronic
926125398 2:10268596-10268618 TGATTCTCAAAGTGTGGCTCAGG + Intergenic
926219797 2:10927258-10927280 TGGTTCTCAAAGTGCTATCCAGG - Intergenic
926242182 2:11096803-11096825 TGGTTCTCCAAGTGTGGCCTTGG + Intergenic
926566967 2:14486775-14486797 TGGTTCTCAAAATGCGATCATGG + Intergenic
927226879 2:20775489-20775511 TGGTTCTCAATGTGTGGTACTGG - Intronic
927340501 2:21978415-21978437 TGATTCACAAGGTGTGGTCCTGG + Intergenic
927551372 2:24002976-24002998 TGGTTCTCAAAGTGTGCCTGAGG - Exonic
927776503 2:25907921-25907943 TAGCTCTCAATGTGTGGTCCTGG - Intergenic
928015350 2:27651221-27651243 TGGTTCTCACATTGTGGACCAGG + Exonic
928547181 2:32339246-32339268 TGCTTCTCAAAGTATGGTCTGGG + Intergenic
928924313 2:36561909-36561931 TGGTTCTCAAAGTGTAGTCCAGG + Intronic
929078003 2:38094536-38094558 TGGTTCTCAAAGTGTGGTCCAGG - Intronic
929125434 2:38519203-38519225 GTGTTCTCAAATTTTGGTCCTGG + Intergenic
929125813 2:38521839-38521861 TGGTCTTCAACGTATGGTCCTGG - Intergenic
929155349 2:38784012-38784034 TGCTTCTGCAAGTGTGGTCTGGG - Exonic
929190974 2:39139295-39139317 TGGTTCTCAAAGTGTTGTTCTGG + Intergenic
929412340 2:41711012-41711034 TGGCTCTCAAAATGTGGTAAGGG + Intergenic
929623630 2:43383718-43383740 TGTCACTCAAAGTGTGGTTCTGG - Intronic
929773764 2:44914988-44915010 TAGTTCTCCAAGTGTATTCCTGG + Intergenic
929866570 2:45722483-45722505 TGGTTCCCAAAGTGTGGTCTGGG - Intronic
929924757 2:46198892-46198914 CAGTTCTCAAAGTGAGGTCTGGG + Intergenic
929939541 2:46322586-46322608 TGGTTCTCATAGTGTGGTCCAGG - Intronic
930023775 2:47017321-47017343 TGGGTCTCACTATGTGGTCCAGG - Intronic
930131360 2:47854773-47854795 TGGTTCTCAAAGCGTGATCCTGG - Intronic
930176230 2:48304019-48304041 TGGTTTTCAAACTGTGTTCTTGG + Intergenic
930606077 2:53494444-53494466 TAATTCTCACACTGTGGTCCTGG - Intergenic
930792319 2:55347265-55347287 TAGTTCTTAAAGTGTAATCCAGG + Intronic
930814905 2:55585780-55585802 CAGTTCTCAAAGTGTGGTCCAGG + Intronic
931118096 2:59186291-59186313 TGGTTCTCAAAGTGTGGTCCTGG + Intergenic
931279265 2:60774341-60774363 TAGTTCTCAAAGTATGGTCTGGG - Intronic
931802987 2:65776988-65777010 TGGTTCTCAAAGCGCAGTCCTGG - Intergenic
931990322 2:67783618-67783640 TGCTCATCAAAGAGTGGTCCAGG - Intergenic
932158331 2:69438100-69438122 CGGTTCTCAAAGTGCGGACTAGG + Intergenic
932378203 2:71256991-71257013 TGATTTTCAAAGTGTGATCCAGG + Intergenic
932631390 2:73346245-73346267 TGACTCTCAAACTGTGGTCCTGG + Intergenic
932817172 2:74871248-74871270 GGCTTTTCAAAGTGTGCTCCTGG - Intronic
933135971 2:78736239-78736261 TGATTCTCAAAGTGTGGTCTTGG + Intergenic
933264659 2:80169075-80169097 TGGTACCCATAGTGTGGTGCAGG - Intronic
933282535 2:80347689-80347711 TGCTACTCAAAGTGTAGTTCCGG + Intronic
933599376 2:84314517-84314539 TGGTTCTCAAAGCGTGGTCCTGG - Intergenic
933652382 2:84859829-84859851 TGGTTCTCAAAGTGTGTCCCTGG - Intronic
933654816 2:84878922-84878944 CAATTCTCAAAGTATGGTCCAGG + Intronic
934048745 2:88192542-88192564 TGTTTCTCAAATGGTGCTCCAGG - Intergenic
934057748 2:88266654-88266676 TGTTTCTCAAAGTGTGGTCCAGG - Intergenic
934064180 2:88324427-88324449 TGGTTCTCAGAGTTTCCTCCAGG - Intergenic
934098877 2:88632832-88632854 TGTTTCTTAAAGTGTGGCCCTGG + Intergenic
934099119 2:88635154-88635176 TGTTTCTTAAAGTGTGGCCCTGG + Intergenic
934668662 2:96192726-96192748 AGGGTTTCACAGTGTGGTCCAGG - Intronic
935214712 2:100966996-100967018 TGCTCCTCAAAGCGTGGTCTAGG + Intronic
935282668 2:101532694-101532716 TGCTACTCAAAGAGTGGTCCGGG - Intergenic
935336350 2:102020848-102020870 TGGCTCTCAAGGGGTGGTCCTGG + Intronic
935469269 2:103437344-103437366 AGGTTCTCAAAGGGTGGCCCTGG - Intergenic
935646628 2:105341798-105341820 TGCCACTCAAAGTGTGATCCAGG - Intronic
935799453 2:106678961-106678983 AGGATCTCCAAGTGTGGCCCAGG - Intergenic
936234901 2:110733828-110733850 TGGTTCTCAAAGTGTGGTACAGG + Intronic
936486418 2:112929586-112929608 TGCTAGTCAAAGTGTGGTCTGGG + Intergenic
936527361 2:113250587-113250609 TGGTTTTCAAAGTGTGACCCTGG - Intronic
936746172 2:115579239-115579261 TGTTTCTCAAAGTGTGCTGGTGG - Intronic
936903626 2:117511975-117511997 TGATTCTTAAAATGTGGTCCTGG + Intergenic
936972905 2:118191913-118191935 TGCTTTTCAAAATGTGGTCCAGG + Intergenic
936976976 2:118230282-118230304 CAGTTCTCAGAGTGTGGTCCGGG + Intergenic
937008265 2:118538268-118538290 TGGTTCTCAATGTATGGTGCAGG + Intergenic
937233306 2:120415161-120415183 CAGTTCTCAAAGTGTGGCCAAGG - Intergenic
937437255 2:121890597-121890619 TGCTTCTCAAGGTGTGGTCCTGG - Intergenic
937438237 2:121896634-121896656 GGGTTCTCAAAGTGGGGCCCTGG + Intergenic
937442583 2:121929580-121929602 TGGTTCTCAGAATGTGAACCGGG + Intergenic
937638616 2:124186169-124186191 TGGATCTCAATGTGTGGTTCTGG - Intronic
938240253 2:129737869-129737891 TGGTTTTCAAGCAGTGGTCCAGG - Intergenic
938604146 2:132874862-132874884 TGTTTCTCAAGGTGTGTTTCTGG - Intronic
938629928 2:133155431-133155453 GGGTTCTCAAAGTGGAGTCCTGG - Intronic
938635259 2:133218533-133218555 AAGTTCTCAAAGTTTGGTCCTGG - Intronic
938679233 2:133672324-133672346 AACTTCTCAAAGTGTGGTCCAGG + Intergenic
938809922 2:134843590-134843612 TGGTTCTCATGCTGTGGTGCAGG - Intronic
938915359 2:135933207-135933229 TGGTTCTGAAAATGTGGTCTGGG + Intronic
939147304 2:138431449-138431471 TGTTTCTCAAAGTGTGGCCCTGG + Intergenic
939516687 2:143177594-143177616 TGATTCTCAAAGGGTGATCTAGG + Intronic
939517432 2:143186684-143186706 TGATTCCCAAATTGTGGTCCTGG - Intronic
939529092 2:143335188-143335210 TATTTCTCAAAGTATGTTCCAGG - Intronic
940175721 2:150875612-150875634 TGGTTCTCAAAGTTGGTCCCTGG - Intergenic
940225681 2:151399059-151399081 TATTTCTGAAAGTGTGGTTCTGG - Intergenic
940590687 2:155721561-155721583 GGGGTCTCACTGTGTGGTCCAGG - Intergenic
940851610 2:158692722-158692744 TGGTTCTTGAAGTGTGGTATGGG - Intergenic
940917074 2:159267494-159267516 TGGGTCTCACTGTGTTGTCCAGG + Intronic
941094059 2:161215180-161215202 TGGTTCTCAAAATATGGTCCAGG - Intronic
941635721 2:167932947-167932969 TGGTTCTCAAAGTGTGATCCAGG + Intergenic
941843051 2:170108068-170108090 TGGTTCTAAAAGTTTCTTCCAGG + Intergenic
942050540 2:172136468-172136490 TAGTTCTCAAACTGTGGCCCAGG - Intergenic
942303778 2:174586738-174586760 TGCTACACAAACTGTGGTCCTGG + Intronic
942328269 2:174794059-174794081 TGGTCCCCAAAGTGTGATCCTGG + Intergenic
942342392 2:174961909-174961931 TCATTCTCAAAGCATGGTCCAGG - Intronic
942934181 2:181534104-181534126 TGGTTCCCAAAGTGTGGTCTTGG - Intronic
943668635 2:190636972-190636994 GTGTTCTCCAAGTGTGGTCTAGG + Intergenic
943736885 2:191366057-191366079 TGGCTCTCAAAATGTGATCCTGG - Intronic
944801067 2:203238620-203238642 TGATTTTCGAAGAGTGGTCCCGG - Intronic
944889688 2:204104415-204104437 TGTTTCTCAAGGTGTGTTCTGGG - Intergenic
945005717 2:205403558-205403580 AGTTTCTCAAAATGTGGTCCAGG + Intronic
945169077 2:206977184-206977206 TACTACTCAAATTGTGGTCCAGG + Intergenic
945221323 2:207487288-207487310 TGGTTCTCAAAATGTGTTCTGGG + Intergenic
945223502 2:207508137-207508159 TGGGTCTCAAAATGTGGTCCTGG + Intergenic
945815840 2:214604147-214604169 TGGCTCTCCAAGCGTGGCCCTGG + Intergenic
945815968 2:214605167-214605189 TGCTACACAAAGTATGGTCCAGG + Intergenic
946132742 2:217619965-217619987 TGTTTCTCAAACTATGTTCCAGG + Intronic
946217097 2:218192852-218192874 TGGCTCTCAAAGTGTTGTCTTGG + Intergenic
946331501 2:219011822-219011844 TGGAGCTCAAAGGGTGGTCCAGG - Intronic
946630466 2:221662104-221662126 TGTTTCTCAAAGTGTGGTCTGGG - Intergenic
946666153 2:222052007-222052029 TGCTACTTAAAGTGTGGTCCAGG + Intergenic
947039193 2:225895784-225895806 TGTTTCTCAAAGTGTGGTCCCGG - Intergenic
947085276 2:226444240-226444262 TGCTACTCAAAGCGTGGTCTGGG + Intergenic
947161867 2:227223121-227223143 AAGTTCTCAGAGTGTGGTCTGGG + Intronic
947605495 2:231483167-231483189 GGCCTCTCAAACTGTGGTCCTGG + Intronic
948241834 2:236444500-236444522 TGGCTCTCAAAGTGTGTCCCAGG - Intronic
948241844 2:236444536-236444558 TGGCTCTCAAAGTGTGTCCCAGG - Intronic
948373945 2:237508637-237508659 TGGTCTTCAAAGTGTGGTCCAGG - Intronic
948679792 2:239626041-239626063 TGGTGCTAAAAGTGAGGCCCGGG + Intergenic
948734050 2:239987445-239987467 TGGTTCGCCGAGTGTGGTCTCGG - Intronic
1168912462 20:1460244-1460266 CAGTTCTCAAAGTGTGGTCATGG + Intronic
1168990709 20:2094016-2094038 TGGTTCTCAAAGCATGGTTCCGG + Intergenic
1169033114 20:2428521-2428543 CGGTTCTCCAAGTGTGGTCCTGG - Intronic
1169503662 20:6185481-6185503 TGGTTCTCAACGTGTGGTCCTGG + Intergenic
1169908095 20:10623838-10623860 TGGTTCTTAGCGCGTGGTCCTGG + Exonic
1170348785 20:15417287-15417309 TGGTTCGTAAAGTGTGGTCCTGG + Intronic
1170411670 20:16098911-16098933 TGGTTCTCACAGTGTGTTCCAGG + Intergenic
1170459660 20:16565466-16565488 TGATTCTCCAAGTGTGGTCCAGG - Intronic
1170815933 20:19714377-19714399 TGGGTCTCATTGTGTTGTCCAGG - Intronic
1170816158 20:19716180-19716202 TGGTTCTCAGAGGGTGGTTTTGG - Intronic
1170852876 20:20020208-20020230 TGATTCCCAAGGTGTGGGCCAGG - Intronic
1170853053 20:20021219-20021241 TGATTCTCAAGGAGTGGGCCAGG + Intronic
1171214302 20:23341205-23341227 TTGTTTTCAAAGTGTGGTCCCGG + Intergenic
1171342161 20:24438618-24438640 TGGTTTTCAAGGTGTGGTGATGG - Intergenic
1171462887 20:25308851-25308873 TGGTCCACCAGGTGTGGTCCTGG - Intronic
1172026174 20:31950375-31950397 TGGTTTTCAGATTGTGGACCTGG - Exonic
1172222772 20:33285057-33285079 CATTTCTCCAAGTGTGGTCCAGG + Intronic
1172242979 20:33425634-33425656 AGGTTCTCACTGTGTGGCCCAGG - Intronic
1172263907 20:33593897-33593919 CAGTTCTCAAAATATGGTCCTGG - Intronic
1172666648 20:36605080-36605102 TGGTTCACAAAGTGAGCTTCCGG - Intronic
1172886496 20:38234648-38234670 TGCTGCTCAAAGTGTGGTCTGGG - Intronic
1172901934 20:38341690-38341712 TGATTCTCAATGTATGATCCAGG + Intergenic
1172955198 20:38751848-38751870 TATTTCTCAAACTGTAGTCCTGG - Intronic
1172965912 20:38835123-38835145 TGCTTCTCAAAGTGTGGTCTGGG - Intronic
1173022967 20:39283363-39283385 CATTTCTCAAAGGGTGGTCCAGG - Intergenic
1173401296 20:42728353-42728375 TGCTACTCAAAGTGTGATCATGG - Intronic
1173881951 20:46421855-46421877 TGGATCTCACTGTGTTGTCCAGG - Intronic
1174933057 20:54836658-54836680 TGCTCCTCAAAGTGTGGTCCTGG + Intergenic
1175780504 20:61679444-61679466 TGGTCCTCAACGTGGGGTGCTGG - Intronic
1176014206 20:62920613-62920635 TGGTTCTCAAAGCGTGGTCCAGG + Intronic
1177079878 21:16626149-16626171 TGGTTCTCAAATAGTGGACCTGG - Intergenic
1177718034 21:24865940-24865962 TGGTTCTCAGAGTTTGAACCTGG + Intergenic
1178058428 21:28825344-28825366 TGGTTCTCAAGGCGTGATCCTGG - Intergenic
1178758126 21:35372608-35372630 AGGCTCTCATGGTGTGGTCCAGG - Intronic
1178904570 21:36625733-36625755 TGTTTCCCAAAGTGTGTTCCTGG - Intergenic
1178956506 21:37027635-37027657 AGGGTCTCAATGTGTTGTCCAGG + Intergenic
1179112768 21:38461585-38461607 TCATTCTCAAAGTGTTGTCCAGG + Intronic
1179175856 21:39007573-39007595 TGGTCCTCAAGGTGTGCTCTTGG + Intergenic
1179277055 21:39901313-39901335 TAGTTCCCAAAGTGTGAACCAGG - Intronic
1179349110 21:40590818-40590840 TGGTTATCATGGTGAGGTCCAGG + Intronic
1179396618 21:41045938-41045960 TGGAAATCAAAGTGTGGTTCAGG + Intergenic
1179482245 21:41685718-41685740 TGGTTGGCAAGGTGGGGTCCAGG - Intergenic
1179953895 21:44727335-44727357 TGTTTCTCAAAGTGGGGTCAGGG - Intergenic
1181405063 22:22678510-22678532 AGCCACTCAAAGTGTGGTCCTGG - Intergenic
1181408218 22:22700155-22700177 AGCCACTCAAAGTGTGGTCCTGG - Intergenic
1182367938 22:29791182-29791204 GGGATCTCACAGTGTTGTCCAGG - Intronic
1182494543 22:30696513-30696535 TGCTTCTCAGAGTGTGGTCCTGG - Intronic
1182854999 22:33509251-33509273 TGGTTCTCAACAGGTGGCCCTGG - Intronic
1182876904 22:33700136-33700158 TGGTTCTCAAAGGGTTGTCCTGG + Intronic
1183692377 22:39397938-39397960 AGGTTCTCACTGTGTTGTCCAGG - Intergenic
1184348605 22:43928322-43928344 TGCTTCGCAAAGTGTGATCCTGG + Intronic
1184466217 22:44669940-44669962 GGGCTCTCCAAGTGAGGTCCTGG + Intronic
1184771804 22:46601380-46601402 AGGTTCTCAAAGTGTGGCCCAGG - Intronic
1185155782 22:49192625-49192647 TGGGGCTCAAAGTGTGAGCCAGG + Intergenic
949279083 3:2325009-2325031 TAGTTCTCAAAGTCTGGTCGAGG + Intronic
949329881 3:2909874-2909896 TGGTTCTCAAACGGTGGTCTTGG - Intronic
949460430 3:4286931-4286953 ATGTTCTCAAAGTGTGGTCCAGG + Intronic
949465630 3:4340243-4340265 TGGTTCTCAAAGTGTGGTCCCGG - Intronic
950346254 3:12296304-12296326 TGGTTCTTAAAATGTGGTCCTGG + Intronic
950353765 3:12384638-12384660 CAGTTCCCAAAGTGTGGTCTGGG + Intronic
950369333 3:12515115-12515137 CAGTTCTCAAAGGGTGGTCTGGG - Intronic
950393491 3:12715570-12715592 TGGTTCTCAAAGTGTGGCCCAGG + Intergenic
950436300 3:12982514-12982536 TGTTTCTCAAAGTGTGGTCCAGG - Intronic
951053333 3:18119285-18119307 TGGTTCTCAAACTGAGGGCCAGG + Intronic
951109229 3:18782397-18782419 TGGTTTTTAAAATGTGGGCCTGG + Intergenic
951445408 3:22774133-22774155 TTGTACTCTAAGTGTGGTCCTGG + Intergenic
951479779 3:23148076-23148098 TGGTTCTCAAGGCATGATCCAGG + Intergenic
951496463 3:23333158-23333180 TGGTTTTCAAACTGTGTTCCAGG + Intronic
951522177 3:23620347-23620369 GTGTTCTCAAAGTGTGATCTCGG + Intergenic
951643454 3:24861883-24861905 TGGTTCTTAAACTGTGATCCAGG - Intergenic
951696804 3:25453591-25453613 TGCTCAGCAAAGTGTGGTCCTGG - Intronic
951805776 3:26642303-26642325 TGGCTCTCAAAGTTTGGTCCAGG - Intronic
952058634 3:29480208-29480230 TTGTTCTTAAAGTGTGGTCCTGG + Intronic
952065012 3:29558850-29558872 TGGTTCTCAATGTGTGATTCTGG - Intronic
952110015 3:30111606-30111628 TGGTCCTTAAAGTGTGGTCCGGG - Intergenic
952187351 3:30984399-30984421 TGCCTCTCAAAGGGTGGTCCTGG - Intergenic
953154067 3:40353002-40353024 TGTTTCTCAAAGCTTAGTCCTGG + Intergenic
953161959 3:40429053-40429075 TGGTTTTGAAAAAGTGGTCCAGG - Intergenic
953164640 3:40453853-40453875 TGTTTCTCAAATTGTGTTCGGGG + Intergenic
953206103 3:40830876-40830898 TGGTTCTCAAATGTTTGTCCAGG + Intergenic
953227882 3:41036975-41036997 TGTTTCTCAAAGTGAGGTAGAGG + Intergenic
953356982 3:42264517-42264539 TGGGTCTAAAAGTGAGGTCTGGG - Intronic
953934805 3:47032175-47032197 TGGTTCTCAAAGTTTGGTGTGGG - Intronic
953955830 3:47231314-47231336 TGCTACCCCAAGTGTGGTCCTGG + Intronic
954371602 3:50171961-50171983 AGTTTCTCAGAGTGAGGTCCTGG + Intronic
954564124 3:51583976-51583998 CAATTCTCAAAGTGTGGTCTGGG - Intronic
954642941 3:52112890-52112912 TGGTTCTCCAAGTGAGTCCCTGG + Intronic
955295016 3:57727052-57727074 TGCTATTTAAAGTGTGGTCCTGG - Intergenic
955550617 3:60081119-60081141 TGCTTCTCCAAGTTTGGTGCAGG + Intronic
955956032 3:64291275-64291297 TGCTACTCAAAGTGTGGTCCAGG + Intronic
955969747 3:64426447-64426469 TGGTTCTCAAACTGTGGTCCTGG + Intronic
955991569 3:64633337-64633359 TGGTTCTCAAAGTGTGGCCCCGG - Intronic
956030340 3:65030487-65030509 TGGTTCTCAAAGTGTAGTCTTGG - Intergenic
956098927 3:65747191-65747213 TGGTTCTCAAACTGTGTTTAGGG + Intronic
956308864 3:67856915-67856937 TGGTTCTCAAAGCGTGTTTATGG + Intergenic
956469913 3:69555576-69555598 TAGTTCCCAAAGTGTCATCCAGG - Intergenic
956689135 3:71859981-71860003 CGGTTCTAAAAGGGTGTTCCAGG + Intergenic
956826140 3:72997813-72997835 TGCTTCTCGAAGTGTGGTCCGGG - Intronic
956871917 3:73426847-73426869 TAGTTCTCAGAGTAGGGTCCTGG - Intronic
956873124 3:73437494-73437516 CTGTTCTCAAAGTGAGGCCCGGG - Intronic
956892832 3:73629096-73629118 TGCTGCTCAAAGTGTGGTCTGGG + Intergenic
957080515 3:75632330-75632352 TGGTTATCAAAGGGTGGAGCTGG - Intergenic
957996648 3:87698588-87698610 TGATTCTCAAAGTGTGGTCCAGG + Intergenic
958031395 3:88115223-88115245 TGGTATTCAAAGTGTGGTTCAGG - Intronic
958112048 3:89161172-89161194 TGGTCCTTAAAGTGTGATCCAGG - Intronic
959091974 3:101912560-101912582 TGCTACTCAAAGTATGGTCTGGG + Intergenic
959244753 3:103851463-103851485 TGCTCCTTAAAGCGTGGTCCCGG - Intergenic
959593065 3:108100293-108100315 TGGTTCTCAAAGGATGCTACTGG + Intergenic
959902016 3:111672206-111672228 TGCTACTCAAAGTGTAGTCTGGG + Intergenic
959981243 3:112520094-112520116 AGTTTCTCAAAGTGTGATTCAGG + Intergenic
960660771 3:120055913-120055935 TGGTTCTCAAACTGTAGTCTTGG + Intronic
961243731 3:125434032-125434054 TGGTACTCCAAGTGTGGTACTGG - Intergenic
961412416 3:126732051-126732073 TGGGTCTCACAATGTGGTCCAGG - Intronic
961566670 3:127768950-127768972 TGGTTCTCAAAGTGTGATTCTGG - Intronic
961927083 3:130492561-130492583 TGTTTCTCAAAGTGGGGTTCAGG + Intergenic
961939797 3:130625153-130625175 CGGTTCTCAAAGTGTGCTGTGGG - Intronic
961991205 3:131193394-131193416 AAGTTCTCAAACAGTGGTCCAGG - Intronic
962019570 3:131484236-131484258 TGGTTCTCAATGTGTGTTTCCGG + Intronic
963288698 3:143464650-143464672 CGATTCTCAAAATGTGGCCCTGG + Intronic
963690542 3:148495807-148495829 TTGTTCTCAAAGTTGGTTCCTGG - Intergenic
963734421 3:149003738-149003760 TGCTCCTCAAACTGTGGCCCGGG - Intronic
963973294 3:151453063-151453085 AGGTCCTCATAGTGTGGTGCTGG - Intronic
964054202 3:152432788-152432810 TGTTTCTCCAAGCCTGGTCCCGG + Exonic
964120769 3:153180707-153180729 TGGTTCTCAAAGTGGGGTCCTGG + Intergenic
964292055 3:155192477-155192499 TGGTACTCAAAGTGAGATCAAGG + Intergenic
964914986 3:161829800-161829822 TGGTTCCCAAAATGGGATCCGGG + Intergenic
965159147 3:165109001-165109023 TGGTTCTGCAAGTGTGGTTGAGG - Intergenic
965294837 3:166931558-166931580 AGGTTCTCAAAGTGTGGTCCGGG + Intergenic
965437476 3:168670580-168670602 TGTTTCTCAAAATTTGGTTCAGG + Intergenic
965488365 3:169306810-169306832 TCCTTCTCAAAGTGTGGGCAAGG + Intronic
965570340 3:170165909-170165931 TGGGTCTCACTGTGTTGTCCAGG - Intronic
965599001 3:170436740-170436762 TGTTTCTCAAAGTGTAGTGTGGG - Intronic
965689674 3:171342307-171342329 TGGTTCTCAAAATATGTTCCTGG - Intronic
965866216 3:173207129-173207151 AGCTACTCAAAATGTGGTCCAGG - Intergenic
965927219 3:173996470-173996492 GGTTTCTCAAATTGTGGTCCAGG - Intronic
966385525 3:179393824-179393846 TGGTTCTCAAAGTTTGGTCCTGG + Exonic
966426109 3:179781424-179781446 TGGATCTAAAAGGGTAGTCCTGG - Intronic
966715184 3:183007317-183007339 TGATTCTCAAAAGGTAGTCCAGG - Intergenic
966927528 3:184655116-184655138 TGGTTTTCAAAGTGTGTCCCTGG - Intronic
966990276 3:185222767-185222789 GGGTTCTTAAAGTGTGGTCCAGG - Intronic
967005644 3:185379831-185379853 TGGTTCTCAAAGTGTGGTCCGGG + Intronic
967094991 3:186170323-186170345 TGGTTCTCAAAGTCTGGTCCTGG + Intronic
967391707 3:188962462-188962484 TGGTGATCATAGTGTGGTCAGGG + Intronic
968193694 3:196689769-196689791 CGCTTCTCAAAGTGTGGTCTGGG + Intronic
968576263 4:1367658-1367680 TGGTTCCCAGAGCGAGGTCCCGG - Intronic
969213434 4:5705844-5705866 TGGTTCTTAAGGTGGGGCCCAGG - Intronic
969216900 4:5730432-5730454 TGGTTCCCAATGTGGGTTCCAGG - Intronic
969283272 4:6185756-6185778 TGGTTCTCAAAATGAGGTCCTGG - Intronic
970833836 4:20376369-20376391 TAGTTCTCAAAGTGATTTCCAGG - Intronic
971893393 4:32556008-32556030 TGTTTCTTAATGTGTGGTCCAGG - Intergenic
972262905 4:37428648-37428670 TAGTTCTCACAGTGTGGACCTGG - Intronic
972275986 4:37558417-37558439 TGGCTCTCAGCGTGTGGTCCCGG + Intronic
972503238 4:39697333-39697355 TGGTTCTCATAATGTGGTCCCGG + Intergenic
972566324 4:40272559-40272581 CACTTCTCAAATTGTGGTCCAGG - Intergenic
972728222 4:41765403-41765425 TGGTTCTGAACGTATGGTCTGGG - Intergenic
973232707 4:47860731-47860753 TGGTTCTCAATGTGTGCTCTTGG + Intronic
973234876 4:47889769-47889791 TAATTCTCAAAGTATAGTCCAGG + Intronic
973810097 4:54561110-54561132 TGGTTCCCAAATTGTGGCCCTGG + Intergenic
974015814 4:56647851-56647873 TGCTACTCAAAGTGTGTTCCAGG - Intergenic
974209450 4:58750460-58750482 TGGGTCTCAATGTGTTGCCCAGG - Intergenic
974800339 4:66809352-66809374 TAGTTCTTAAAGTGTGGTCTAGG - Intergenic
974873369 4:67672464-67672486 TAGTTTTCAAAGTGTGGTCCAGG - Intronic
975790704 4:77946761-77946783 TGGTTCTCAGAGTGTGGTCCAGG + Intronic
976069865 4:81229181-81229203 TGGTTCACAAAATGTGGTCCAGG - Intergenic
976671261 4:87656767-87656789 TGCTTCTTAAAGTGTCATCCTGG + Intronic
976714044 4:88104350-88104372 AGGTTCTCAAAGTTTTGTTCAGG - Intronic
976920357 4:90433420-90433442 TAGTTCTTAAAGTATGGTCAAGG + Intronic
977069807 4:92370828-92370850 TGGTTACCAAAGGGTGGGCCTGG + Intronic
977389246 4:96386674-96386696 TGCTTCTCAAAGTTTGGTCTGGG + Intergenic
977432845 4:96953826-96953848 TGGTTTGCAAAGTATGTTCCAGG + Intergenic
977458030 4:97287085-97287107 AGGTTCTCCAAGTGTGATCTGGG - Intronic
977546589 4:98389210-98389232 TGGTTCTCAAAAAGTGTCCCTGG - Intronic
977630272 4:99234949-99234971 TGTTTCTCAAAGTATGGTCCTGG - Intergenic
977903374 4:102448442-102448464 TGCTGGTCAAAGTGTGGTTCAGG - Intergenic
977923778 4:102675163-102675185 TGGTTCTTTAAGTGTGGCCTGGG + Intronic
978196298 4:105976181-105976203 GGGTTCTCAAAGTCTGATGCTGG + Intronic
978428787 4:108610433-108610455 TGCTGCTCAAAGAGTGGTCAAGG + Intergenic
978454388 4:108871980-108872002 AGGTTCTCAAAGTGTGCTCTGGG + Intronic
979767545 4:124480426-124480448 TCCTTCTCAAAGTCTGGTCATGG + Intergenic
979784496 4:124698553-124698575 TGTTTCTCAGAGTGTGGTATGGG + Intronic
980160170 4:129151525-129151547 TGTTTCTCAAAGTGATTTCCTGG - Intergenic
980236370 4:130112480-130112502 TAGTTCTCAAAGTGTGTTCTTGG + Intergenic
980887177 4:138775812-138775834 CAGTTCTCAGAGTGTGGCCCAGG - Intergenic
981133071 4:141180153-141180175 TGGCTCACAAAGTGAGGTCTTGG + Intronic
981763429 4:148219437-148219459 GGGTTCTCAAATTGTGGCCCAGG + Intronic
982031945 4:151309796-151309818 TGGGTCTCAATGTGTTGCCCAGG - Intronic
982032246 4:151312547-151312569 TGTTGCTCAAAATGTGGCCCAGG + Intronic
982082965 4:151807995-151808017 TGTTTCTCAAAGTGTGGTCTGGG + Intergenic
982092700 4:151894283-151894305 TGGTTCTCAAAGACTGGCCCTGG + Intergenic
982123602 4:152165113-152165135 TGTATCTCAAAGTGTGGTCTGGG - Intergenic
982150146 4:152445125-152445147 TGTTTTCCAAAGTGTGGTTCAGG - Intronic
982210713 4:153033193-153033215 GGCTTCTCAAAGAGGGGTCCAGG - Intergenic
982240152 4:153292037-153292059 CAGTTCTCAAAGTGTGGTCCAGG + Intronic
982260024 4:153486966-153486988 TGTTTCTCGAAGCCTGGTCCAGG + Intronic
982562012 4:156940611-156940633 AGGTTCTCAAAGTGTGGTCTGGG + Intronic
982593250 4:157343969-157343991 TGGTTCTCAAAATGTTTTCTAGG + Intronic
982671482 4:158325100-158325122 TGGGTCTCACTGTGTTGTCCTGG + Intronic
982687728 4:158511515-158511537 TGGTTCTCATGGTGTGGTCCTGG - Intronic
982737884 4:159025106-159025128 TGCTACTCAAAATGTGGTCTGGG + Intronic
982865277 4:160502296-160502318 TGCTACTCAAAGTGTGATCCAGG - Intergenic
983094216 4:163542795-163542817 TGATTCTCAAAGTATGGTCCTGG - Intronic
983544294 4:168946326-168946348 TGGTTCTCAAAGTATGGTCCAGG + Intronic
983581059 4:169310425-169310447 TTTTTCTCAAAGTGTGGCCTGGG + Intergenic
983641192 4:169945351-169945373 TGATTCTCAAAGTGAGGTCCAGG - Intergenic
985450401 4:190058885-190058907 TGGTTATCAAAGGGTGGAGCTGG + Intergenic
1202758196 4_GL000008v2_random:84315-84337 GGGGTCTGAAAGTGTGGTCCGGG + Intergenic
986292517 5:6411464-6411486 TGGTTCTCAAAGGGTGTGCCAGG + Intergenic
986770395 5:10967587-10967609 CGTTACTCAAAGTGTAGTCCGGG - Intergenic
987302633 5:16610069-16610091 TGGCTCTCAAAGTGAGGTCCTGG - Intronic
987725209 5:21689045-21689067 TGTTTCTCAATGTGTTGTCCTGG + Intergenic
988337977 5:29930762-29930784 TGTTTCTACAAGAGTGGTCCAGG + Intergenic
988914841 5:35882043-35882065 TGGGTCTCTATGTGTTGTCCAGG + Intergenic
989001280 5:36763113-36763135 TGGTTCTCAAAGTGTGGTCCTGG - Intergenic
989145359 5:38244212-38244234 TGGTTCTCAAAGTATGGTCTGGG - Intergenic
989621869 5:43392465-43392487 TGGTTCTCCAAATGTGTTCCAGG - Intronic
990022550 5:51145385-51145407 AGGTTCTCACTGTGTAGTCCAGG + Intergenic
990043829 5:51403814-51403836 TGGTTCTCAATATGTGCTCTGGG - Intergenic
990122944 5:52478122-52478144 TGGTTTTCAAACTGTGGCCCCGG + Intergenic
990174743 5:53094962-53094984 TGCTCCTCAAAGTGTGGCCCAGG + Intergenic
990533572 5:56697731-56697753 CGGTTCTCAAAGTGTGGTCCTGG - Intergenic
990585963 5:57211481-57211503 TAGTTCTTAAAGTATGGGCCTGG - Intronic
990967710 5:61467598-61467620 TGATTCTCAATGTATGGTCCTGG - Intronic
991193610 5:63905621-63905643 TGGTTCTCAAAGTGTGGCCCTGG + Intergenic
991286554 5:64983470-64983492 CGGTTCTCAAAGTGTGACTCGGG - Intronic
991357037 5:65779282-65779304 TGCTTCTCAAAGTGTGGCCCTGG - Intronic
992178068 5:74170404-74170426 TGGGTCTCACTGTGTGGCCCAGG - Intergenic
992693911 5:79265505-79265527 TGCTACTCAAAGTATGGTCTGGG - Intronic
993234283 5:85282860-85282882 TGGTTCTCAAAGTGTCCTCCAGG + Intergenic
993536093 5:89088038-89088060 TGGTTCTTAAACTGTGGTGGAGG + Intergenic
993600141 5:89912424-89912446 TAGTTTTCAAAATGTGGTCCCGG + Intergenic
993696844 5:91071440-91071462 TGGTTCCCAAAGTGTGTTCCAGG + Intronic
993710336 5:91217847-91217869 TGTTTCTCACGGTGTTGTCCAGG + Intergenic
993818674 5:92585645-92585667 TGATTTTCAAAGTGTGGTTTGGG - Intergenic
993882910 5:93383613-93383635 TGGTACTCAAAGTGAGGTCCAGG + Intergenic
994009182 5:94879815-94879837 TGGGTCTCAGGGTGTGGTTCAGG - Intronic
994523478 5:100873079-100873101 TGCTACTCAAAGTGTGGTCTTGG - Intronic
994632522 5:102303664-102303686 TTGTTCTCAAAATGTGATCCAGG + Intergenic
994782068 5:104102917-104102939 TGCTTCTCAAAGCGTGGTCAGGG - Intergenic
994927785 5:106140853-106140875 TTGTTCTCAAAGTGTGGACAGGG - Intergenic
995060013 5:107803434-107803456 TGGCTCTCAAAGTTTGATTCTGG - Intergenic
996564973 5:124870278-124870300 TGGTTCTCAAAGTGTGGAAAAGG + Intergenic
996728194 5:126691320-126691342 CAGTTCTCAAAGTGTGATCCTGG - Intergenic
996881998 5:128309266-128309288 TGGTTCACAAGGTTTGTTCCAGG + Exonic
997614784 5:135238969-135238991 TGGATAGCAAAGTGTGGACCTGG - Intronic
997720551 5:136075321-136075343 TGTTTCTAAAAGAGTGGTCCTGG + Intergenic
998559314 5:143156426-143156448 TGGTTCTCAGAGTGTGGTCCTGG + Intronic
998674759 5:144394987-144395009 TGGTTCTCAAAGCCTGGTCCTGG + Intronic
998806266 5:145920246-145920268 CTGTCCTCAACGTGTGGTCCTGG + Intergenic
998884985 5:146684765-146684787 GATTTCTCAAAGTGTGGTCCAGG + Intronic
999104131 5:149054476-149054498 TGCTACTCCAAGTGTGGTCCTGG - Intronic
999228158 5:150044650-150044672 TGGTTCTCAAAGGGTGGTCCTGG - Intronic
999301420 5:150493001-150493023 TGGTTCTGAAAGTTGGGTTCTGG + Intronic
999396487 5:151232384-151232406 TGGCTCTCAAAATGTGGACCAGG + Intronic
999492978 5:152069844-152069866 GGGTGCTCAAAGTGTGTTACAGG + Intergenic
999553080 5:152711321-152711343 TGTTTTTCAAATTGTAGTCCAGG + Intergenic
999599143 5:153241401-153241423 TGATTCTCAAAGTGTTGTCTTGG + Intergenic
999823006 5:155247508-155247530 GAGTTCCCAAAGTGTGATCCGGG - Intergenic
1000060898 5:157654445-157654467 TGGTTCTCAAAGTGTGGTATGGG - Intronic
1000744836 5:165019786-165019808 TTGTTCTCAAAGTGTGGCTCTGG - Intergenic
1001017394 5:168153823-168153845 TGCTTCTCAAAGTGTGGTCCTGG - Intronic
1001053823 5:168433335-168433357 TGCTACCCAAAGTGTGATCCAGG - Intronic
1001127066 5:169029338-169029360 TTGTTCTCAAAGGGTGGCCCTGG + Intronic
1001225793 5:169943668-169943690 TGGTTCTCAAGGTGTGGTCCTGG + Intronic
1001238328 5:170048747-170048769 TGGTTCAGAAACTGTGCTCCAGG - Intronic
1001368715 5:171173831-171173853 AAGTTCTCAAAGTATGGTCCTGG - Intronic
1001488056 5:172134061-172134083 TAGTTCTCAAAGTGTGACCAGGG - Intronic
1001700078 5:173700497-173700519 TGGTCTTCAAAGTGTGATCCCGG - Intergenic
1002019423 5:176353276-176353298 TGGTCCTCAAGGTGTGGTCTTGG - Intronic
1002029076 5:176415219-176415241 TGGTTTTCCAAAGGTGGTCCGGG - Intronic
1002301410 5:178259408-178259430 TAGTTCTCAAAGTGTGGTCCTGG - Intronic
1002371015 5:178754718-178754740 TGCTACTCAAAGTGTGGCCTGGG + Intergenic
1002707020 5:181168544-181168566 TGGCTCTAAGAGTGTGGTGCTGG + Intergenic
1002923037 6:1586680-1586702 AGGGTCTCACTGTGTGGTCCAGG + Intergenic
1002950492 6:1805447-1805469 CAGTTCCCAAAGTATGGTCCAGG + Intronic
1003525591 6:6894119-6894141 AAGTTCTCAAAGTGTGGTCCTGG - Intergenic
1004273721 6:14217056-14217078 TGTTTTTCAAAGTGAGGTCACGG + Intergenic
1004473966 6:15953761-15953783 TGATTCTCAAGGTGTGGACTCGG + Intergenic
1004536712 6:16510211-16510233 TGTTCCTCAAAGTGTCTTCCTGG + Intronic
1004607525 6:17207806-17207828 TGGGTCTCACTGTGTTGTCCAGG - Intergenic
1004745637 6:18506706-18506728 GGGCCCTCAAAGTGTGGTCCTGG + Intergenic
1005872676 6:29986763-29986785 TGATTCTCAAAGTGTGTTCCTGG - Intergenic
1006033353 6:31193740-31193762 TGATTCTCAAAGTGTAGTCCTGG + Intergenic
1006056608 6:31389736-31389758 TGGTTCTCAAAGTGTGGTCCTGG + Intergenic
1006069332 6:31486715-31486737 TGGTTCTCAAAGTGTGGTCCTGG + Intergenic
1006288317 6:33114989-33115011 TGGTTTTCAAATTGTGCTCTGGG + Intergenic
1006574909 6:35037946-35037968 TGGGTCTCAGAGTCTGGGCCAGG + Intronic
1006966409 6:37990214-37990236 TGATTCTCAAAGTATTGTCCAGG - Intronic
1007034260 6:38658497-38658519 TGGTCCTCACAGTGTGGTCCTGG + Intergenic
1007112540 6:39321227-39321249 CAGTTCTCAAAGTGTAGTCCCGG - Intronic
1007270562 6:40633283-40633305 TGGTTCTCAAAGCATGGTCCAGG + Intergenic
1007497718 6:42272450-42272472 CGCTGCTCAAAGGGTGGTCCAGG + Intronic
1007680082 6:43627970-43627992 TGGTTCCCAAAGTGAGGTCCTGG + Intronic
1007896413 6:45365604-45365626 TGGTTTTCAAAATGTGCTTCAGG + Intronic
1008486456 6:52041410-52041432 TGGTCCTTAAAGTGTGGTCCTGG - Intronic
1008508357 6:52253160-52253182 TACTGCTCAAAGTTTGGTCCTGG + Intergenic
1008698776 6:54073704-54073726 TGGTCCTCAAAGTCTGTTTCAGG - Intronic
1008896183 6:56558516-56558538 TAGTTCTCCAAGTGTGCTCCTGG - Intronic
1009825501 6:68861091-68861113 TGGTTCTCAGACAGTGGCCCAGG - Intronic
1011232530 6:85178756-85178778 TGGTTCCAGAAGTGTTGTCCAGG + Intergenic
1011413380 6:87090204-87090226 TGGTTCTCAAAGTGTGATCTGGG + Intronic
1011434098 6:87319033-87319055 GGGTTCCCAAAGTGTGCTCTGGG - Intronic
1011786809 6:90855765-90855787 TGGTTCTCAAAGTGCAGCCTGGG - Intergenic
1011982914 6:93406726-93406748 TGCTTGTCAAAGTGTGGATCTGG - Intronic
1012317964 6:97803576-97803598 TATTTCTCAAAGTGTGATCTAGG - Intergenic
1012620489 6:101339013-101339035 TGGGTCTAGAAGTGTAGTCCAGG + Intergenic
1013108618 6:107047409-107047431 AGGGTCTCACTGTGTGGTCCAGG + Intronic
1013578730 6:111510971-111510993 CAGTTCTCAAAGTATGTTCCTGG + Intergenic
1013605294 6:111741910-111741932 TGGATCTCAGAGTGTAGCCCAGG - Intronic
1013697424 6:112720326-112720348 TGATTCTCAAAGTGTTCTCTGGG + Intergenic
1014072326 6:117197199-117197221 TGGTTCTCAAAATGTGCTTCCGG + Intergenic
1014143956 6:117975035-117975057 TGGCTCTCCAAGTGTGGTGTGGG - Intronic
1015113605 6:129620762-129620784 TAATTCTCAAAGTGTAGTCCAGG + Intronic
1015115679 6:129646887-129646909 TGGTTTTCAAAGCGTGGTCTGGG - Intronic
1015202564 6:130599837-130599859 TGGTTCTGTAAGTTTGGGCCTGG - Intergenic
1015461411 6:133495855-133495877 TGGTTCTCAAAATGCAGCCCAGG - Intronic
1015462308 6:133505427-133505449 TAGTTCTCTAAGTGTAATCCAGG - Intronic
1015497357 6:133895304-133895326 TGATTGTTAAAATGTGGTCCTGG - Exonic
1015529946 6:134211740-134211762 TGCTGCTCAAAATGTAGTCCAGG - Intronic
1015619155 6:135112050-135112072 TGACTCTCAAAGTGTGGTCTGGG + Intergenic
1016051413 6:139534311-139534333 TGGCTCTGAAGGTGTGGTCTGGG - Intergenic
1016076523 6:139803202-139803224 CAGTTCCCAAAGTGTGGTCTCGG + Intergenic
1016379026 6:143454348-143454370 TGGTTCTCAAAGTGTGGCATGGG - Intronic
1016940304 6:149477807-149477829 TGGTTCCCAAGGTGTGGTCTAGG + Intronic
1017051844 6:150400662-150400684 TGCTACTCAAAGAGTGGTCCTGG + Exonic
1017094331 6:150791093-150791115 TGGTTCCCAAAGTGTGGTCTTGG + Intronic
1017142169 6:151201066-151201088 CAGTGCTCAAGGTGTGGTCCTGG + Intergenic
1017364367 6:153616709-153616731 TGCTACTCAAAGTGTGGCCCTGG + Intergenic
1017619954 6:156286507-156286529 TGGCTGTCAAACTGTGGTCCTGG - Intergenic
1017962912 6:159237421-159237443 TGGTTCTCAAAGCATGGTCCTGG - Intronic
1018388255 6:163323649-163323671 CAGTTCTCAAAGTGGGCTCCCGG + Intergenic
1018681413 6:166268921-166268943 CGGGTCTCAAGGTGTGGTCTTGG - Intergenic
1018945996 6:168346900-168346922 TGGTTCCCAAATTCTGGTCCTGG + Intergenic
1019792501 7:3025304-3025326 TGCTACTCAGAGTGTGTTCCAGG - Intronic
1020352572 7:7237285-7237307 TGCTACTCAAAATGCGGTCCTGG + Intronic
1020506495 7:8995651-8995673 TGTTTTTCAAAGAGTGGTTCAGG + Intergenic
1021497994 7:21297554-21297576 TGGTTCACAAAATATGGTCTGGG - Intergenic
1021848209 7:24783214-24783236 CAGTTCTCAGAGTGTGGTCTTGG - Intergenic
1021908221 7:25357754-25357776 TGATACTCAAAGTGGGGTCTAGG - Intergenic
1021929297 7:25563688-25563710 TGATTCCCAAAGGGTGTTCCTGG - Intergenic
1021935143 7:25623159-25623181 TGGTTCCCGAAGTGTAGTCTAGG + Intergenic
1022001759 7:26232682-26232704 TGGGTCTCACTCTGTGGTCCAGG - Intergenic
1022041966 7:26590075-26590097 TTGGTCTCACAGTGTGGTCAGGG + Intergenic
1022131061 7:27405052-27405074 AGGTCCTCAAAGTGTGTTCCAGG + Intergenic
1022212042 7:28220678-28220700 TGGTTCTCAAAGTGTGTTCCTGG + Intergenic
1022274260 7:28840157-28840179 TGACTCTCCAAGTGTGGTCCTGG + Intergenic
1022403309 7:30062432-30062454 TGGTTTTCAAAATGTGTCCCAGG - Intronic
1022419712 7:30209159-30209181 TGGTTCTCAAACTGGGGTTCAGG - Intergenic
1022501628 7:30885667-30885689 TGGTTCTCAAAGTGTGGTCCTGG - Intronic
1022504449 7:30901762-30901784 TAGTGTTCAAAGTGTGGTTCTGG + Intergenic
1022639248 7:32165834-32165856 TGGTTCTCCAGGTGTGATCCTGG + Intronic
1022795299 7:33727152-33727174 TGCCATTCAAAGTGTGGTCCTGG + Intronic
1022810266 7:33861414-33861436 TGTTTCTCAAATTGGGGGCCAGG + Intergenic
1023054388 7:36279819-36279841 CGGTCCTCAAAGTGTGGTCTAGG - Intronic
1023210468 7:37798625-37798647 TGGTTCTCCATATGTGGCCCTGG + Intronic
1023454077 7:40319846-40319868 TGGTTCTCACTTTGTTGTCCAGG + Intronic
1023457935 7:40361933-40361955 TGCTTCTCAAATTTTGGCCCAGG - Intronic
1023523991 7:41079690-41079712 TGGTTCTCAAAGTGTGGCCTGGG - Intergenic
1023535591 7:41205707-41205729 GGGTTCTCAACATGTGGTCTGGG + Intergenic
1023541150 7:41267521-41267543 TGCTACTCACAGTGTGGTCCAGG + Intergenic
1023618696 7:42047865-42047887 TGCCACTCAGAGTGTGGTCCAGG + Intronic
1023908442 7:44537990-44538012 TGGTTCTCAAAGTGTGGCCTGGG + Intronic
1024103435 7:46057334-46057356 GGGTCCTCAAAGTGTGTTCCAGG - Intergenic
1024857274 7:53796337-53796359 TGGTTCTCAGAATGTGGTCTTGG - Intergenic
1024908815 7:54421347-54421369 CAGTTTTCAAAGTGTGATCCAGG + Intergenic
1024935271 7:54705748-54705770 TGGTTCTCAAATGGTGTCCCTGG + Intergenic
1025854443 7:65265199-65265221 TGGTTATCAAAGGGTGGAGCTGG - Intergenic
1026448961 7:70510460-70510482 TGGTTCTCAAAGAGTGGCCCAGG + Intronic
1026531206 7:71199027-71199049 AGGTTCTCAAAGTATTATCCAGG - Intronic
1027002208 7:74661300-74661322 TGGTTCTCAAAGGGCTGTCCGGG - Intronic
1027018013 7:74791108-74791130 TGGGTCTCACCGTGTGGCCCAGG - Intergenic
1027211555 7:76153110-76153132 TGGTTCTCAAAGGTAGTTCCTGG - Intergenic
1027352176 7:77323572-77323594 TAGTTCTGAAAATGTGGTGCAGG - Intronic
1027375290 7:77542060-77542082 TGGTTCTCAAAGTATGGTCCAGG - Intronic
1027499085 7:78925502-78925524 TAGGTCTCAAAGTGTGGCCTAGG + Intronic
1027651393 7:80873024-80873046 TAGTTCTCAAAGCGTGGTCTGGG - Intronic
1028187196 7:87800838-87800860 AGGTTCTCACTGTGTTGTCCAGG + Intronic
1028249005 7:88517680-88517702 CGGTTCTCAAAGTGTGGTCTTGG - Intergenic
1028812617 7:95104963-95104985 TGGCTAGCAAAGTGTGCTCCTGG - Intronic
1028976126 7:96916345-96916367 TGGTTCCTGAAGTCTGGTCCTGG + Intergenic
1029087603 7:98023455-98023477 TGGGTCTCACTGTGTTGTCCAGG + Intergenic
1029293161 7:99518074-99518096 TGGTAATCCAAGAGTGGTCCAGG + Intronic
1029405336 7:100371561-100371583 TGGTTCTCATAATGCGGTGCAGG + Intronic
1029417553 7:100452620-100452642 TAGTTATTAGAGTGTGGTCCTGG - Intergenic
1029460779 7:100693086-100693108 TGCCTCTCAAAGTGTCGTTCTGG - Intergenic
1029659727 7:101952037-101952059 TGGCTGTCAAGGTGTGGCCCAGG + Intronic
1029799908 7:102935674-102935696 ATGTTCTCAAAGAGTGGTCTGGG + Intronic
1029802707 7:102966367-102966389 TGGTTCTCAAAGTGTGGTCCTGG - Intronic
1029814974 7:103084217-103084239 TGGTTATCAGAGTGTGGTCCAGG - Intronic
1029899774 7:104026596-104026618 TGGTTTTCAAAGTGTGATTCAGG - Intergenic
1029969636 7:104776628-104776650 AGGTTCTCAAAGTATGTTCTTGG - Intronic
1030538860 7:110803791-110803813 TAGTTTTCAAAGTATGGTCCTGG + Intronic
1030586503 7:111426434-111426456 TGTTTCCCAAAGTGAGTTCCAGG - Intronic
1030875768 7:114811305-114811327 TGCTACTCAGAGTGTGGTCTGGG + Intergenic
1031235963 7:119176954-119176976 CTTTTCTCAAAGTGTGGTCTTGG + Intergenic
1031500758 7:122512777-122512799 TGGTTCTCAAGGTATAGTCTTGG + Intronic
1031713024 7:125073016-125073038 TGGTTCTCAAAATGTAGTCCTGG + Intergenic
1032019018 7:128396380-128396402 TGCTTCTCAGAGTGCGGTCAAGG - Intronic
1032406596 7:131660346-131660368 TGTTTCTCAAAGTGTGCCCAGGG - Intergenic
1032491726 7:132328983-132329005 TGGTTCTCAAAGCGTGGTTCTGG + Intronic
1032539818 7:132693714-132693736 GGGTTTCCAAAGAGTGGTCCAGG - Intronic
1034145078 7:148863137-148863159 CAGTTCTCAAAGTGTGGCCTGGG - Intronic
1034387199 7:150749645-150749667 TGGTACTGAAGATGTGGTCCGGG + Intronic
1034701126 7:153097143-153097165 TGTTCCTCAAAGTCTGGCCCAGG - Intergenic
1035148341 7:156843275-156843297 TGCTTCTCACACTGTGGTCAGGG - Intronic
1035734781 8:1880256-1880278 CGGTTCTCAAAGGGTGGTCCGGG + Intronic
1035994307 8:4529128-4529150 TGATTCTCAAAGTATGTTCCAGG + Intronic
1036034003 8:4999487-4999509 TGGTTCTCACAGTGGAATCCTGG - Intergenic
1036615826 8:10386697-10386719 TGGTTTTCAAAGTGTGATCCTGG - Intronic
1036735759 8:11314402-11314424 TGTTTCTCAAAGTGTGGTCTAGG + Intronic
1037164434 8:15810088-15810110 TGGTTCTCATAGTGTGTCCTTGG + Intergenic
1037616886 8:20527372-20527394 TGGTTCTCAAAGTGTGGCTGGGG - Intergenic
1037720603 8:21440279-21440301 TGGTTCTCAAAGTGGGGTCCAGG - Intergenic
1038932527 8:32210480-32210502 CGGTTCTCAAAGTGTGGTCCAGG - Intronic
1039594377 8:38778135-38778157 GGGCTCTCACTGTGTGGTCCAGG + Intronic
1039852739 8:41384409-41384431 TGGCACTCAAAGTGTGACCCAGG - Intergenic
1040004112 8:42604069-42604091 CAGTTCTCAAAATGTAGTCCAGG + Intergenic
1041215901 8:55599795-55599817 TGGTCCTCAGAGTGTTGTCATGG - Intergenic
1041414253 8:57589988-57590010 GGGTTCTCAAACTGTGATCCCGG + Intergenic
1041441105 8:57897971-57897993 AGGTTCTGAAAGTGTGGTCTTGG + Intergenic
1041589156 8:59556770-59556792 TGGGTCTCAAAGTGTGGTCTGGG - Intergenic
1041697115 8:60747700-60747722 TGGTTCTAAAATTGTGGGCCAGG - Intronic
1041913082 8:63110593-63110615 TGGCTCACAAAGTACGGTCCAGG + Intergenic
1041952573 8:63520424-63520446 TGTTTCTGAAAGTGTGATTCTGG + Intergenic
1042002209 8:64137110-64137132 TGTCTCCCAAAGTGTGTTCCTGG - Intergenic
1042166569 8:65951393-65951415 TGCTCATCAAAGAGTGGTCCTGG - Intergenic
1042758368 8:72243342-72243364 TGGCTCTGAAAGTGTGGTTTGGG - Intergenic
1042950221 8:74193597-74193619 AGGTTCTCAAACTGTGCTTCAGG - Intergenic
1043538008 8:81227370-81227392 AGGGTCTCACAGTGTTGTCCAGG + Intergenic
1043607638 8:82022034-82022056 TGCTTCTCAAAATGTGGGCCAGG - Intergenic
1043715964 8:83486885-83486907 TGGTTCTAAACATGTGGTCCAGG + Intergenic
1044173017 8:89080529-89080551 TAGTTCTCAAAGTATAGCCCAGG + Intergenic
1044230908 8:89776665-89776687 TGGTTCTTAAAGTGTGGTCCAGG - Intronic
1044852022 8:96437940-96437962 TGGTGCTCAAAGCCTGGCCCAGG - Intergenic
1045100277 8:98837118-98837140 TAGTTCTTAAAGTGTGATCCAGG - Intronic
1045184458 8:99822993-99823015 TGGTTTTCAAAGGGTGGTCTGGG - Intronic
1045219104 8:100179498-100179520 TAGTTCTTAAAGTATGGTCTAGG + Intronic
1045420995 8:102014972-102014994 TGGTATTCAAAGGGTGGTCCAGG - Intronic
1045720712 8:105107359-105107381 CGGTTCTCAATGTGTGGTCCTGG - Intronic
1045901928 8:107292126-107292148 TGCTTCTCAAAATGTGGTCCAGG - Intronic
1046541776 8:115592855-115592877 TGCTACTCAAGGTGTGGTCTGGG - Intronic
1046588108 8:116172698-116172720 CAGTACTCAAAGTATGGTCCAGG - Intergenic
1046680714 8:117166607-117166629 TGGTTCCTGAAGTGTTGTCCTGG - Intronic
1047143531 8:122170219-122170241 TGTTTTTCAAAGTCTGGTCTGGG - Intergenic
1047166447 8:122444623-122444645 TGGTTCTCAAAGTGTGCTCCGGG - Intergenic
1047492147 8:125383991-125384013 GGTTTCTCAAAGTGAGGTCCAGG + Intergenic
1047508835 8:125500737-125500759 TGATTCTCAAAGTCTGGTTTAGG + Intergenic
1047516259 8:125557061-125557083 TGCCTCTCGATGTGTGGTCCTGG + Intergenic
1048396206 8:134016272-134016294 TGGTACTCATAGTGTGGTCCAGG - Intergenic
1049105684 8:140611057-140611079 CGGTTCTCTAAGTGTGGTCCGGG + Intronic
1049842651 8:144783220-144783242 TAGTTCTCAGAGTGTGGCTCAGG + Intronic
1049910142 9:257939-257961 TGGTTCTCAAAATGTGGTCCTGG - Intronic
1049914777 9:306776-306798 CAGTCCTCAAATTGTGGTCCTGG - Intronic
1049951997 9:654255-654277 TGTTTCTCAAAGTCTGGCCGTGG - Intronic
1050097272 9:2079628-2079650 TGGTCCTCAGAATGTGTTCCAGG - Intronic
1050221142 9:3391602-3391624 TTTTTTCCAAAGTGTGGTCCAGG + Intronic
1050339463 9:4621282-4621304 TGACTCTCAATGTGTGGTCCAGG + Intronic
1050346916 9:4698683-4698705 AGATTCTCAAGGTGGGGTCCAGG + Intronic
1050501857 9:6306860-6306882 TGTTTCTCAAATCATGGTCCAGG + Intergenic
1051390708 9:16560203-16560225 TGATTCTCAGAGTATGGTCCTGG - Intronic
1051436011 9:17033069-17033091 TGGTTCTCATGATGTGTTCCAGG - Intergenic
1051784359 9:20725680-20725702 TGTTTCTCAAATTGTGGGCTTGG - Intronic
1052243158 9:26299503-26299525 TGTTTCTCAAAGTAGGGTCCAGG - Intergenic
1052646597 9:31243950-31243972 TGGTTCTCACTATGTTGTCCAGG + Intergenic
1052759708 9:32577913-32577935 AGGTTCTCAAAGTTTGGCCCAGG - Intergenic
1052821832 9:33143661-33143683 CGTTTCTCAAAATGTAGTCCAGG - Intronic
1053217333 9:36283120-36283142 TAGTTATCAAAGTGTGGTCTGGG - Intronic
1053313120 9:37031945-37031967 TGGTGCTCAAAGGGTTGTCCAGG - Intronic
1053314826 9:37042283-37042305 TGTTTCTCAATGGATGGTCCAGG - Intergenic
1053395774 9:37772791-37772813 AGGTTCTCAATGTGTTGCCCAGG - Intronic
1054715691 9:68555989-68556011 TGCTACTCAAAGTGTGGTCTAGG - Intergenic
1054820257 9:69515026-69515048 CAGTTCTCAAATTGTCGTCCTGG + Intronic
1054887983 9:70219878-70219900 TGGTTCTCAAAGTTTGGTCCAGG + Intronic
1054946528 9:70802096-70802118 CTGTTCTCAAAGTATGGTCCTGG - Intronic
1055082486 9:72280966-72280988 CAGTTCTCAAAGTGTGGCCTGGG - Intergenic
1055400473 9:75918450-75918472 TGGCTCTCAAAGTGTGGCCCTGG - Intronic
1055515430 9:77028597-77028619 AACTTCTCAAAGTGTGGTCTGGG + Intergenic
1055685142 9:78765212-78765234 TGCTTCTCAAAGTGTGGTCCAGG + Intergenic
1055988242 9:82076383-82076405 TGATTCTCAAAGTATGGTCTGGG - Intergenic
1056028105 9:82521914-82521936 TGCCACTCATAGTGTGGTCCAGG - Intergenic
1056125282 9:83530758-83530780 TGGTTCTCAAAGTGTTGTCTGGG - Intronic
1056188642 9:84163137-84163159 AGGCTCTCAAAGTGTGGTCAGGG + Intergenic
1056230613 9:84539210-84539232 TGGGTCTAAAAGTGTTGTCCAGG + Intergenic
1056671188 9:88628449-88628471 TGGTTCTCAAAGTATGGTCCAGG - Intergenic
1056782553 9:89562149-89562171 TGGTCCCCAAAGTTTTGTCCTGG + Intergenic
1056989357 9:91395855-91395877 TGCTATTCAAAGTGTGGTCCAGG - Intergenic
1057358894 9:94355539-94355561 TGGTTCTCAAAGTGTGGCATAGG - Intergenic
1057361754 9:94379580-94379602 TGGGTCTCACTGTGTTGTCCAGG + Intronic
1057648860 9:96902053-96902075 TGGTTCTCAAAGTGTGGCACAGG + Intronic
1057661603 9:97008591-97008613 TGGGTCTCACTGTGTTGTCCAGG - Intronic
1057783129 9:98066228-98066250 CGGTTTCCAAAGTGTGGTTCAGG + Intronic
1057793871 9:98142339-98142361 TGGTTCCCCAAGTGTGAGCCTGG + Intronic
1057819216 9:98318454-98318476 TGATTGTCAAGGTCTGGTCCAGG - Intronic
1058079524 9:100687516-100687538 TAGTTCTCGAAGTGTGCCCCGGG + Intergenic
1058877821 9:109259431-109259453 AGGTTCTTAAAGTGTTTTCCAGG - Intronic
1058909130 9:109505121-109505143 TGTTTCTGGAAGTGTGATCCAGG + Intergenic
1058968373 9:110057714-110057736 TGCTACTCCAAGTGTGGTCTGGG + Intronic
1059349597 9:113655065-113655087 TGCTTCTCAATGTGTGATCTTGG + Intergenic
1059519220 9:114924252-114924274 TGCTTTTTAAAGTGTGGTCCTGG - Intronic
1060463734 9:123883563-123883585 TAGTTCTTAAAGTATGGTCACGG - Intronic
1060708099 9:125825713-125825735 TGGTTTTCAAACTGTGGCCCAGG - Intronic
1061565004 9:131432827-131432849 TGGCGCTCCAAGGGTGGTCCCGG + Intronic
1061605011 9:131703189-131703211 AGGGTCTCACTGTGTGGTCCAGG + Intronic
1061772809 9:132939803-132939825 TGGTTCTCAAAATGTGGTCCTGG + Intronic
1061968057 9:134027024-134027046 TTTTCCTCAAAGTGTGGTCCTGG - Intergenic
1185692820 X:2170339-2170361 AGGTTCTCACTCTGTGGTCCAGG - Intergenic
1186347901 X:8713370-8713392 TGACTTTCAAAGTGTGGTACTGG + Intronic
1186421791 X:9432626-9432648 TGGTTCTCACACTGTGATCCTGG - Intergenic
1186545516 X:10445082-10445104 TGCTATGCAAAGTGTGGTCCAGG - Intergenic
1186616961 X:11199302-11199324 TGGTTCTTAAAATGTAGTTCTGG + Intronic
1186628334 X:11319477-11319499 CAGTTCTCAAAGTGTAATCCCGG - Intronic
1186746328 X:12573676-12573698 TGATTCTCAAAGTGTGATCTAGG + Intronic
1186773531 X:12840727-12840749 TGGTTCTCAAAGTGAGGCCCTGG + Intergenic
1186809646 X:13175724-13175746 TGCTTTTCAAAATGTGGTCCTGG + Intergenic
1186815927 X:13238100-13238122 TGCTACTCAAAGTGTGATCTTGG + Intergenic
1186884378 X:13898425-13898447 TGCTGCTCAAAGTATGGTTCTGG + Intronic
1186970401 X:14835625-14835647 TGGTTCTCAAAGTGTGGTCCTGG - Intergenic
1186978218 X:14931239-14931261 TGTTACTCAAAGTGTGGTCTAGG - Intergenic
1187787123 X:22904311-22904333 TGGTTCTCAGAGTATGGTTCTGG - Intergenic
1187873319 X:23782752-23782774 CAGTTCTCAAAGTGTGATCCGGG - Intergenic
1188015824 X:25107037-25107059 TGATTCTCTAAGCGTGGTCCAGG + Intergenic
1188018425 X:25130186-25130208 TGGTTCTCAAAAGGTAGTCCAGG - Intergenic
1188022282 X:25171995-25172017 TAGTTCTCAAAGTGTGGTCCTGG + Intergenic
1188084609 X:25888046-25888068 CAGTTCTCAAAGTGTAGTCTGGG - Intergenic
1188378834 X:29466892-29466914 TATTTCTTAACGTGTGGTCCTGG + Intronic
1188395029 X:29671763-29671785 CGGTTCTGAAAGTGGGCTCCTGG - Intronic
1188407271 X:29827189-29827211 TGGTTCTCAAAGTGTGGTCCAGG - Intronic
1188571718 X:31594268-31594290 TGGTTCTCAAAATGGGGGGCGGG - Intronic
1188604843 X:32015551-32015573 TAGTTCTCAAAGGGAGGTCCCGG - Intronic
1188613289 X:32125874-32125896 TATTTCTTAAAATGTGGTCCTGG + Intronic
1189028411 X:37424277-37424299 TGATTCTCAAACTGTGGTAATGG + Intronic
1189099161 X:38171388-38171410 TGGTTCCCATGGTGTGGTCCTGG - Intronic
1189122530 X:38409668-38409690 TGCTTCTCAAAGTGTGGCCCTGG - Intronic
1189273726 X:39769852-39769874 AGTTCCTCCAAGTGTGGTCCAGG + Intergenic
1189344656 X:40231979-40232001 TGCTTTTCAAAGTGTGTTCCCGG + Intergenic
1189350343 X:40271101-40271123 TGGTTCTCGAAGCATGGTCCTGG + Intergenic
1189560003 X:42182831-42182853 TTCTTCTCCAAGTGTTGTCCAGG + Intergenic
1190576041 X:51839907-51839929 TGGTTCTCAAAATGTGGTCCAGG + Intronic
1190717224 X:53114811-53114833 TGGGTCTGCAAGGGTGGTCCTGG + Intergenic
1191786348 X:64920737-64920759 TGATTCTCAAAATGTGGCCAAGG + Intronic
1192188961 X:68979077-68979099 TGGTTCTCCAGGGGTGGTCCAGG - Intergenic
1192264211 X:69527867-69527889 TGCTCTTCAAAGTGTGGACCTGG - Intronic
1193547547 X:82848406-82848428 AAGTTCTCAAAGTTTGGACCAGG + Intergenic
1193731155 X:85105493-85105515 TGGTCCTTAAAGTGTGGTTTTGG - Intronic
1193936877 X:87634115-87634137 TGCTAATCAAGGTGTGGTCCTGG + Intronic
1194062723 X:89224282-89224304 TGGTTCTCAAAGTGGGATCCAGG - Intergenic
1194222741 X:91215477-91215499 TGGTTCTTAAAGTGTGTTTCTGG + Intergenic
1194721521 X:97346154-97346176 TACTACTCAAAGTGTGGGCCTGG + Intronic
1195352870 X:104011311-104011333 TGGTTTTCAAAGTGTTGCTCCGG + Exonic
1195400667 X:104458009-104458031 TGGTATGCAAAGTCTGGTCCTGG - Intergenic
1195740220 X:108057735-108057757 AGGTTCTTAAAGTCTTGTCCAGG - Intronic
1195798178 X:108676840-108676862 TGATGCTTAAAGTGTGGTCCTGG + Intronic
1195954372 X:110313943-110313965 AGGTTCTCAACGTGTGGCCCTGG + Intronic
1195955928 X:110330401-110330423 TGTTACTCAAGGTGTGGTCATGG + Intronic
1196041965 X:111214508-111214530 TTGTTCTTAAAGTGTTGTCCTGG + Intronic
1196202476 X:112901038-112901060 TTATTCTCAAAGTGTGGTCCTGG + Intergenic
1196203576 X:112913525-112913547 TTATTCTCAAAGAGTAGTCCTGG + Intergenic
1196502236 X:116398564-116398586 TAGTTCTCAAAATGTGGTCCAGG + Intergenic
1197175138 X:123477651-123477673 TTGTTCTCAAAGTGTGGTCCAGG - Intronic
1197809057 X:130425289-130425311 AGAGTCTCAAAGTGTCGTCCAGG - Intergenic
1197852794 X:130881553-130881575 TGTTTCTCAAAATGTGGTTTAGG - Intronic
1198090695 X:133326324-133326346 TGGTTCTCAAAGTGTGGGCCTGG + Intronic
1198467665 X:136917903-136917925 TTATTTTCAAAGTGTGGTCTGGG + Intergenic
1198572073 X:137968202-137968224 ACTTTCTCAAAGTGTGGTCCTGG + Intergenic
1198628679 X:138609042-138609064 TGGTTCTCAATATATGGTCGTGG + Intergenic
1199273126 X:145909089-145909111 TGCTACTCAAAGTGTGGTTCAGG + Intergenic
1199704669 X:150413436-150413458 TTGTTCTCAAACAGTGTTCCTGG - Intronic
1199759912 X:150897895-150897917 TGCTACTCAAAATGTGGTCCAGG - Intronic
1199802074 X:151261703-151261725 TGTTTCTCAAAGTATGGTCCTGG - Intergenic
1199804321 X:151282596-151282618 TGTTTCTCAAAGTGTGGTTCTGG + Intergenic
1199814272 X:151384041-151384063 CGCTCCTCAATGTGTGGTCCTGG + Intergenic
1199858404 X:151778778-151778800 GGTTTCTCAAAGCGTGGCCCAGG - Intergenic
1200559219 Y:4678935-4678957 TGGTTCTTAAAGGGTGTTTCTGG + Intergenic
1200716593 Y:6553261-6553283 TGGTTCTCAAAGTGTGATCCAGG - Intergenic
1200842229 Y:7794305-7794327 TGGTTCTCAGAGTGTGATCTGGG - Intergenic
1201417902 Y:13766255-13766277 TGGCTTTCAAAGTGTGGTACTGG - Intergenic
1201736897 Y:17277190-17277212 TACTACTCAAAGTGTGGTTCTGG + Intergenic