ID: 931118097

View in Genome Browser
Species Human (GRCh38)
Location 2:59186292-59186314
Sequence GGTTCTCAAAGTGTGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2791
Summary {0: 14, 1: 133, 2: 405, 3: 820, 4: 1419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931118088_931118097 26 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118097 2:59186292-59186314 GGTTCTCAAAGTGTGGTCCTGGG 0: 14
1: 133
2: 405
3: 820
4: 1419
931118089_931118097 25 Left 931118089 2:59186244-59186266 CCCACGCTAGTAGTCAAAAGTGG No data
Right 931118097 2:59186292-59186314 GGTTCTCAAAGTGTGGTCCTGGG 0: 14
1: 133
2: 405
3: 820
4: 1419
931118091_931118097 24 Left 931118091 2:59186245-59186267 CCACGCTAGTAGTCAAAAGTGGT No data
Right 931118097 2:59186292-59186314 GGTTCTCAAAGTGTGGTCCTGGG 0: 14
1: 133
2: 405
3: 820
4: 1419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931118097 Original CRISPR GGTTCTCAAAGTGTGGTCCT GGG Intergenic
Too many off-targets to display for this crispr