ID: 931118098

View in Genome Browser
Species Human (GRCh38)
Location 2:59186293-59186315
Sequence GTTCTCAAAGTGTGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 4, 1: 6, 2: 52, 3: 120, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931118088_931118098 27 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118098 2:59186293-59186315 GTTCTCAAAGTGTGGTCCTGGGG 0: 4
1: 6
2: 52
3: 120
4: 413
931118091_931118098 25 Left 931118091 2:59186245-59186267 CCACGCTAGTAGTCAAAAGTGGT No data
Right 931118098 2:59186293-59186315 GTTCTCAAAGTGTGGTCCTGGGG 0: 4
1: 6
2: 52
3: 120
4: 413
931118089_931118098 26 Left 931118089 2:59186244-59186266 CCCACGCTAGTAGTCAAAAGTGG No data
Right 931118098 2:59186293-59186315 GTTCTCAAAGTGTGGTCCTGGGG 0: 4
1: 6
2: 52
3: 120
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931118098 Original CRISPR GTTCTCAAAGTGTGGTCCTG GGG Intergenic
900625387 1:3606184-3606206 GTTCTCAAAGTGGGGTCCCCCGG + Intronic
901648602 1:10729574-10729596 GTTCGCAAAGCGTGGTCCGCAGG + Intronic
902176942 1:14657501-14657523 GTCCCCAAAGTGTGGTCCCTGGG - Intronic
903240949 1:21982256-21982278 GTTCTCAAAATGTGGTACCTGGG + Intronic
903792859 1:25906403-25906425 GTGCTCAGAGTGTGGTCAGGCGG - Exonic
905006182 1:34712250-34712272 GCTCTCAAACTGCAGTCCTGGGG + Intergenic
905009749 1:34739341-34739363 GTTCTCAAAGTGTAGTCCAGGGG + Intronic
905425751 1:37882906-37882928 GTCCTCACAGTGTGATCTTGTGG - Exonic
905461408 1:38125291-38125313 GTTCTCAAAGTGTAGGCCCCAGG - Intergenic
905542121 1:38768139-38768161 GTTCTGTCAGTGTGCTCCTGTGG - Intergenic
905816114 1:40952373-40952395 GTTCTCAAAGTGTGTTCCCCGGG - Intergenic
906487518 1:46243197-46243219 GTTATCCAAGTGTGGTGGTGTGG - Intergenic
906600853 1:47127948-47127970 GTTCTCAAAGTCCTGTCCTCCGG - Intergenic
906819610 1:48915589-48915611 GTTCTCATAGTGTGTTCCCTTGG + Intronic
907206885 1:52780843-52780865 TTTATCAAAATGTGGTCCTTTGG + Intronic
907213920 1:52846161-52846183 GTTTTCAAAGTGTGGACCCCAGG + Intronic
907360792 1:53912932-53912954 GTTCTCAAAGTGTGGTTCCTGGG - Intergenic
908035331 1:60045675-60045697 GTTCTTAAAGTGTAGTCTTTGGG + Intronic
908123263 1:61005754-61005776 GTTTTCAAAGTGTGTTCTTCAGG - Intronic
908617315 1:65936699-65936721 GTTCCCAAAATGTGGTCCCTAGG - Intronic
908704967 1:66943255-66943277 TTTCTCAAATTGTGCTCCTATGG + Intronic
909339698 1:74517922-74517944 GTTCTCAAAGTGTGATGCCTGGG - Intronic
911045791 1:93626430-93626452 GTGCTCAAAGTGTGTTCCACAGG + Intronic
911237027 1:95422615-95422637 TTTCTCAATGTGTGGTTCTGCGG + Intergenic
911473214 1:98343852-98343874 GTAACCAAAGTGTGGTCATGAGG + Intergenic
913420260 1:118659428-118659450 CATCTCAAAGTGTGTTCCTATGG - Intergenic
914974112 1:152342437-152342459 GTTCTCAATATGTAGTCTTGGGG + Intergenic
915044167 1:152997939-152997961 TTTCTCAAAGTGTGGTCTGCAGG + Intergenic
915080849 1:153350841-153350863 GTTCTCAAAAAGTGGCCCAGGGG + Intergenic
917004891 1:170403457-170403479 GTTCTTAAAGGGTGATCCTTGGG + Intergenic
917036911 1:170758177-170758199 CTTCCCAAAGTGTGGTTCAGTGG - Intergenic
917075237 1:171198079-171198101 GTTCTCAAAGTGTGGTCACATGG - Intronic
918419838 1:184352982-184353004 GTTCTCCAAGTGTGGTTCTGGGG - Intergenic
919447721 1:197730040-197730062 GCTCTCAAAGTGTAGTCTAGGGG - Intronic
920729553 1:208470166-208470188 TTTCACAAAGTGTGGTCTTTTGG + Intergenic
921259612 1:213374410-213374432 TTTCTCAAAGTGTGTTCCATTGG - Intergenic
921424122 1:214982793-214982815 GTTCTCAATGTGTGGTCCCTGGG + Intergenic
921856909 1:219996402-219996424 GTTCTCAAAGCATGGTCCCTGGG + Intronic
922355214 1:224768952-224768974 GTTCTCAAAGAGAGTTCCTTAGG - Intergenic
922375885 1:224965228-224965250 ATTCTCAAAATGTGGTCCCCAGG + Intronic
922609170 1:226911630-226911652 CTTCTCAAAGTGTGGTCCTGGGG + Intronic
923028705 1:230229094-230229116 GTTTTCAAACTGTGACCCTGGGG - Intronic
923251877 1:232185450-232185472 CTTCTCAAAGTGGGGCCATGGGG - Intergenic
923463804 1:234231189-234231211 GCTCTCCAAGTGTGGTCCCTGGG - Intronic
923542382 1:234897807-234897829 GTTCTCAAAGTGTGGTCCTTGGG - Intergenic
924098749 1:240582101-240582123 GTTCTCAAAGTGTGGTTCCCTGG - Intronic
924268879 1:242311467-242311489 GTTCTCAAAGTGTGGTCCCTGGG - Intronic
1063022578 10:2144452-2144474 GTTCTCAAATTATGCTCCTGTGG + Intergenic
1063421862 10:5918600-5918622 GTTCTCAAAGTGTGGTTCTCAGG + Intronic
1064748236 10:18499163-18499185 ATTCTCAGTGTGTGATCCTGAGG + Intronic
1065220908 10:23495147-23495169 GTTCTTAAAGTGGGGTCCCCAGG - Intergenic
1065389680 10:25169851-25169873 GTTCTCAAAGTGTGATCCCTGGG + Intergenic
1065458457 10:25932493-25932515 GTTCTCAGAGTGTGGTCTAGGGG - Intergenic
1065639132 10:27763797-27763819 CTATTCAAAGTGTGGTCCTTGGG - Intergenic
1066455031 10:35565264-35565286 GTTCTCAGAGTGTGGGCCCGGGG + Intronic
1066518498 10:36190127-36190149 GTACTCAGAGTGTTGTCCTCAGG - Intergenic
1066716033 10:38287298-38287320 GTTCTCAAAGTGTGGTCCCTGGG + Intergenic
1067190655 10:44065194-44065216 CTTCTCAAAGTGGGGTCCCTGGG - Intergenic
1067699524 10:48558797-48558819 GTTCTCAAAGTGTATTCCCCAGG - Intronic
1068143542 10:53036242-53036264 GGTCTCAAACTGTGGACCTCAGG + Intergenic
1068688622 10:59893978-59894000 GATCACAAAGGGTTGTCCTGAGG + Intronic
1069658777 10:70109604-70109626 CTACTCAAAGTGTGGTCCATAGG + Intronic
1070465575 10:76719856-76719878 GTCCACAAAGTGTGGCCATGGGG - Intergenic
1070481580 10:76888135-76888157 GGTCACCAAGTGTGGTCCTTAGG + Intronic
1070553597 10:77511243-77511265 GTTCTCAAAATGGGGTCCCTGGG - Intronic
1070739262 10:78891934-78891956 GTTCTAAAAGTATGGTCCCCAGG - Intergenic
1070804364 10:79262205-79262227 GTTCTCAAAGTGGGGTCCCCAGG + Intronic
1071209412 10:83320676-83320698 ATGCTAAAAGTGTGGTGCTGAGG - Intergenic
1071777746 10:88808067-88808089 GTTCTCAAAGTATGGGCCTTGGG - Intronic
1071798405 10:89030528-89030550 TTTCTCAAATTGTGGTCCCTAGG - Intergenic
1072242444 10:93509439-93509461 GTTCTCAAAGCGTGGTCCAAGGG - Intronic
1072695863 10:97602299-97602321 CATCTCTAAGTGTGGTCCTAGGG - Intronic
1072802732 10:98404736-98404758 GTTCTCAAAGTTATGTTCTGGGG + Intronic
1073513771 10:104059539-104059561 CTACTCAAAGTGTGGTCCACGGG - Intronic
1073562569 10:104509456-104509478 GTTCTCAAAGTGTGGTCCCTGGG + Intergenic
1073635559 10:105194806-105194828 GTTCTCAAAATACGGTCCTGGGG + Intronic
1074208399 10:111304467-111304489 CTTGTCAGTGTGTGGTCCTGGGG + Intergenic
1074251927 10:111759537-111759559 TTTCTCAAAGTGTAGACCTCGGG - Intergenic
1074949237 10:118312884-118312906 GTTTTCAAACTGTGGGGCTGGGG + Intronic
1074954970 10:118379902-118379924 ACACTCAAAGTGTGGTCCTTGGG - Intergenic
1076640352 10:131911757-131911779 GTTCTCAAAGTGCGGTCTGTGGG - Intronic
1076946945 10:133658088-133658110 GTTATCAAAGGGTGGAGCTGGGG + Intergenic
1078565022 11:12407141-12407163 CTTCTCAAAGTGTGATCCTTGGG + Intronic
1079026159 11:16949542-16949564 GTTCTCTAAGTGTGATCCACAGG - Intronic
1079551735 11:21707527-21707549 ATTCTCAAAGTGTGGTCCCTGGG - Intergenic
1080775285 11:35380381-35380403 CTTCTCCAAATGTGGTCCTTGGG + Intronic
1080820284 11:35799311-35799333 GTGGTCAGAGTGTGGGCCTGAGG + Intronic
1080924590 11:36743130-36743152 GTCCTCCAAGTGTGGTCTGGAGG + Intergenic
1081640692 11:44751448-44751470 TTTCTCACAGTGTGGTGGTGAGG + Intronic
1082770021 11:57200744-57200766 CTACTCAAAGTGTGGTCCATGGG - Intergenic
1083061573 11:59878200-59878222 AATCTCAAAGTATGATCCTGGGG + Intergenic
1083067246 11:59937817-59937839 ATTCTCAAAGTGTGGTCCCTGGG + Intergenic
1083204904 11:61142748-61142770 GCTCTCAAAGTGTGTTTCAGGGG - Intronic
1083949004 11:65943555-65943577 TTTCTCAGACTGTGGCCCTGTGG - Intergenic
1085799207 11:79572556-79572578 GTTCTCAAAGTGTGGTCCCCAGG - Intergenic
1086010302 11:82094848-82094870 CTTCTCAAAATGTGTTCCTCAGG - Intergenic
1087085381 11:94213116-94213138 GTTCTCAAAGTGTAGTCTGTGGG + Intergenic
1087221732 11:95553432-95553454 ATTCTCAAAGTGTGGTCTCTGGG - Intergenic
1087252458 11:95918364-95918386 GTTCTCAAAGTTTGGTCTCCAGG - Intronic
1089279330 11:117361929-117361951 GATCTCAAAGCGTGAGCCTGGGG + Exonic
1089403844 11:118181302-118181324 CTTTTCAAAGTGTGGTCCCCAGG + Intergenic
1089778827 11:120858695-120858717 TTTATCAAAGTGTGTTCCTCAGG - Intronic
1090463944 11:126916442-126916464 GTCCTCACAGTGTGGTCCCAGGG - Intronic
1090849868 11:130562635-130562657 TTTCTCAAAGTCTCTTCCTGTGG - Intergenic
1091420467 12:335330-335352 GTTCTCAAAATGGGATCCAGAGG + Intronic
1091446976 12:549495-549517 TTTCTCAAAATGTGTTACTGCGG - Intronic
1091795152 12:3293834-3293856 GTTCTTAAAGTGTGGTTCCAGGG + Intergenic
1091900203 12:4138351-4138373 TTTCCCAAAGTGTGTTCCTCAGG - Intergenic
1092134985 12:6140773-6140795 GCTCTCATACTGTGGTCCTCAGG - Intergenic
1093047116 12:14459671-14459693 TTTCTCAAAGTGTGGTCCAGCGG - Intronic
1093687187 12:22070407-22070429 GTTCTCACAGGGAGGTTCTGAGG + Intronic
1094164372 12:27427374-27427396 GTTCTCAAAGTGTGGTCCCCAGG - Intergenic
1094168624 12:27467536-27467558 GTGCTCAAAGTGTGGTCTGCAGG - Intronic
1094221062 12:27994150-27994172 TTTCTCAAAGTGTGGCCTTTGGG + Intergenic
1094418323 12:30241574-30241596 GTTCTCAAAGTGTAGTCCATCGG + Intergenic
1094429866 12:30356337-30356359 GCTCTCAAAGTGTGGTCCCTTGG - Intergenic
1094497224 12:30995886-30995908 GTTCTCAAAGTGTGGTTCCAGGG - Exonic
1095088939 12:38086479-38086501 GTTATCAAAGGGTGGAGCTGGGG - Intergenic
1095858699 12:46890631-46890653 GTTCTCAAAGTGTGGCCCTCAGG + Intergenic
1096077975 12:48816673-48816695 GTTGTCTAAGTCTGCTCCTGAGG - Intronic
1097669768 12:62521531-62521553 ATTCCCAAAGTGTGGTCCCTGGG - Intronic
1098104559 12:67055805-67055827 GTCCTCAAAGTGTGGCCCAGTGG - Intergenic
1098607824 12:72415153-72415175 GTTCTCCAAGTGAGGTGTTGAGG - Intronic
1099963494 12:89419485-89419507 GTTCCTAAAGTGTGGACCTCAGG + Intergenic
1100337927 12:93650061-93650083 GTTCTCAAAGTGTGGTCCTTGGG - Intergenic
1100650801 12:96586270-96586292 GTTCTCAAAGTATGGTCCCTGGG - Intronic
1100813190 12:98360707-98360729 TTTGTCAGAGTGTGTTCCTGTGG + Intergenic
1101376534 12:104176024-104176046 AGACTGAAAGTGTGGTCCTGTGG - Intergenic
1101457987 12:104857234-104857256 GTTCTCAAAGTGTGGTCTAGGGG + Intronic
1101850800 12:108400457-108400479 GTTCTTAAAATGTGGTCCCTGGG - Intergenic
1102420553 12:112799926-112799948 GTTCTCACAGTGTGGTCCCTGGG - Intronic
1102624849 12:114226755-114226777 CTACTCAAAGTGTGGTCCCTGGG - Intergenic
1102959114 12:117080658-117080680 GTTCTGAAAGTCAGTTCCTGAGG - Intronic
1103015925 12:117494488-117494510 GTTCTCAAAGTGGGGTTCCCTGG - Intronic
1103439903 12:120955321-120955343 GATCTCAAAGTGTGGTCCCAGGG - Intergenic
1103786277 12:123435776-123435798 GTTCTCAAACTGTGGACCCTGGG + Intronic
1104391081 12:128391033-128391055 GTTCTCAAAGTGGGGTTCCTGGG + Intronic
1104423556 12:128656701-128656723 GTTCTCAAAGTGTGGTGCCTGGG - Intronic
1104512405 12:129392571-129392593 GTTCACAAAGTGTGGTCCCCGGG + Intronic
1104585922 12:130047923-130047945 GTTCCCAAAGTGTGTTCCTGAGG + Intergenic
1104589514 12:130073175-130073197 GATCTCAGAGTGTAGCCCTGAGG + Intergenic
1104794693 12:131509352-131509374 GTTCTCAAAGTGGGGTCCCTGGG - Intergenic
1106856022 13:33853822-33853844 TTGCTCCAAGTGAGGTCCTGTGG - Intronic
1108201295 13:48046489-48046511 GTTGTCAAAGTGTGGTCTGGGGG + Exonic
1108405925 13:50101597-50101619 GTTATCAAACTATGGCCCTGAGG + Intronic
1110547222 13:76768808-76768830 GATCAAAAAGTGTAGTCCTGAGG - Intergenic
1112051392 13:95646781-95646803 GGTCTCAAACTGTTGACCTGAGG - Intergenic
1112273170 13:97989119-97989141 GCTCTCAAAATGTGGGACTGCGG + Exonic
1113741355 13:112714338-112714360 GTTCCCACAGTGGGGTCCTGTGG - Intronic
1113893756 13:113749933-113749955 GTTCTTCACGTGTGGTCCTTTGG + Intergenic
1113965479 13:114150603-114150625 GTTCTCAAAGTGTGGTCCCCAGG - Intergenic
1114182898 14:20380568-20380590 AGTCTCAAAGTGTGGCCCTCTGG + Intronic
1114268923 14:21089840-21089862 GTTCTCAAAATGAGGTCCTCAGG + Exonic
1114614989 14:24063497-24063519 GTCCTGGAGGTGTGGTCCTGGGG - Exonic
1114772690 14:25446251-25446273 GTTCTCAAAGCATGGTGCTTGGG + Intergenic
1114854209 14:26418083-26418105 CTACTCAAAGTGTGGTCCATGGG + Intergenic
1115888582 14:38001840-38001862 TTTCTCAAAGTGTGGTCCTGGGG - Intronic
1117904009 14:60565682-60565704 ATTCTCAAAGTGTGGTCTCCCGG - Intergenic
1119003724 14:70906427-70906449 GCCCTCAAAGGGTTGTCCTGAGG + Intergenic
1119436484 14:74600826-74600848 CTACTCAAAGTGTGGTCCCTGGG + Intronic
1119601011 14:75977022-75977044 CTTCTCCAAGTGTGGTCCAGAGG - Intronic
1119625373 14:76169885-76169907 GTTCTCAAAACGTGGTCCCCAGG + Intronic
1119628658 14:76206635-76206657 ATTCTCAATGTGTGGTCCCTAGG + Exonic
1119661188 14:76452966-76452988 GTTCTCAAAGTGTGGCCCTCAGG + Intronic
1119686971 14:76640703-76640725 TTTCCCAAAGTGTGGACCTTGGG - Intergenic
1121099309 14:91239188-91239210 CTACTCAAAGTGTGGTCCATGGG - Intronic
1121632165 14:95429397-95429419 GTTCTCAAAGTGTGGTCCCCAGG + Intronic
1123098993 14:105783039-105783061 GTTCTGGAGGTGTGGACCTGGGG + Intergenic
1123134356 14:106013161-106013183 ATTCTCAATGTGTGACCCTGAGG + Intergenic
1202921017 14_KI270723v1_random:30637-30659 GTTATCAAAGGGTGGAGCTGGGG + Intergenic
1202923897 14_KI270724v1_random:6937-6959 GTTATCAAAGGGTGGAGCTGGGG - Intergenic
1123584381 15:21743605-21743627 ATTCTCAATGTGTGACCCTGAGG + Intergenic
1123621028 15:22186212-22186234 ATTCTCAATGTGTGACCCTGAGG + Intergenic
1123966660 15:25466389-25466411 GTTCCCAAAGTGTGGTCTGCAGG + Intergenic
1124322602 15:28726250-28726272 GGTCTCAAACTGTGGACCTCAGG + Intronic
1124686860 15:31790340-31790362 GTTCTCAAAGTGTGGCCCCTAGG - Intronic
1126710942 15:51455216-51455238 GTTCTTACAGTGTGGTGTTGCGG - Exonic
1127416462 15:58762463-58762485 GTTCTCAAAGTGTGGTTTTTGGG - Intergenic
1127809953 15:62557114-62557136 TTGCTCAAAGTGTGTTCCTAGGG - Intronic
1127904957 15:63369629-63369651 GTTCTCAAAGTGTGGTCCCTGGG - Intronic
1129217716 15:74109753-74109775 GTTCTCAAAGTGTGGTCCCTGGG - Intronic
1130050896 15:80482736-80482758 CTTCTCAAAGTGTAGTCCTTAGG + Intronic
1130690632 15:86078963-86078985 CTTCTCAAAGTATGGTGCTAGGG - Intergenic
1131366536 15:91846419-91846441 CTACTCAAAGTGTGGTCCCTGGG - Intergenic
1131425566 15:92342948-92342970 GTTCTCAAAGTGTGGTCCCCAGG - Intergenic
1131643728 15:94319560-94319582 GTTCTCCAAGTGTGGTTCCTGGG - Intronic
1131668163 15:94591902-94591924 CTACTCAAAGGGTGGTCCTCAGG + Intergenic
1132177158 15:99724963-99724985 GTTCTCCAAGTCTGGTGCAGTGG - Intronic
1132940908 16:2507666-2507688 ATTCTCCAGGTGTGCTCCTGGGG + Intronic
1133627496 16:7584885-7584907 GGTCTCAAAGTTTGCTTCTGTGG - Intronic
1133745417 16:8682779-8682801 CTACTGAAAGTGTGGTCCAGCGG + Intronic
1134360351 16:13525190-13525212 GTTCTCAAAGGGTGGTTCCCAGG - Intergenic
1134538812 16:15047862-15047884 CTTGTCACATTGTGGTCCTGAGG - Exonic
1135474411 16:22761716-22761738 TTTCTCAAAGTGTGGTCCTTGGG - Intergenic
1135559730 16:23466947-23466969 GTCCCCCAAGTGTGGTCCTCAGG + Exonic
1135965893 16:27034644-27034666 GTTTTCAGGGAGTGGTCCTGTGG - Intergenic
1136033273 16:27519026-27519048 GTGCTTAAAGCGGGGTCCTGAGG - Intronic
1136098394 16:27975132-27975154 GCTCTCAAAGTGTGGTTCCCAGG - Intronic
1136772718 16:32855952-32855974 CTCCTCAACGTGTGATCCTGAGG - Intergenic
1136777663 16:32880345-32880367 CTTCTCAGATTGTGGGCCTGTGG - Intergenic
1136892961 16:33981169-33981191 CTTCTCAGATTGTGGGCCTGTGG + Intergenic
1136897896 16:34005567-34005589 CTCCTCAACGTGTGATCCTGAGG + Intergenic
1137618711 16:49861685-49861707 GATCTCATAGGGTGGTCCTGAGG + Intergenic
1137619678 16:49868176-49868198 GGTCGCAAACTGTGGGCCTGGGG - Intergenic
1137826492 16:51501122-51501144 GTTCTTCAACTGTGGTCCTCGGG - Intergenic
1138095980 16:54212322-54212344 GTTCTCAAAGTGGGGTTCCCTGG - Intergenic
1138220518 16:55246426-55246448 GTTTTCAAAGTGTGGTCTTCTGG + Intergenic
1138360244 16:56422354-56422376 TTTCTCAAAATGTGGACCTCTGG - Intronic
1138911175 16:61401062-61401084 GTTCTCAAAGTGCGGTCCTCTGG + Intergenic
1139683311 16:68582125-68582147 GTTCTCAAAATGTAGTCCCTGGG - Intergenic
1139832834 16:69813981-69814003 GTTTTTGAAGTGTGATCCTGAGG + Intronic
1140486636 16:75298817-75298839 GTTCTGAAAGAGTGACCCTGAGG + Intronic
1140767043 16:78169671-78169693 GATCTAAAACTCTGGTCCTGTGG + Intronic
1140823694 16:78686171-78686193 GTTCTCAAAGTGTGGCTCCCAGG + Intronic
1141128305 16:81416926-81416948 GTTGCCACAGTGTGGTCCTCGGG + Intergenic
1142296092 16:89223432-89223454 GTTTCCAGAATGTGGTCCTGGGG + Intronic
1203075143 16_KI270728v1_random:1118062-1118084 CTCCTCAACGTGTGATCCTGAGG - Intergenic
1203080079 16_KI270728v1_random:1142454-1142476 CTTCTCAGATTGTGGGCCTGTGG - Intergenic
1143925793 17:10368748-10368770 ATTCTCAAAGTGTGGTCTGTGGG - Intronic
1144406804 17:14959814-14959836 GTACTCAAAGTGTGGTCTGGGGG - Intergenic
1144838340 17:18170216-18170238 GTTCTCAAAGTGTGGTCGAGGGG - Intronic
1144857665 17:18278635-18278657 GTTCTCCAAGTGTGGTTCCAGGG + Intronic
1145822433 17:27849726-27849748 GTTCTCAAAGTGTTGCCCCTGGG + Intronic
1145900879 17:28489799-28489821 GTTCTCAAAGTATGATCCCTGGG - Intronic
1146052174 17:29562853-29562875 GTTGTCAGAGTGTGGTCTGGGGG + Exonic
1146121668 17:30201173-30201195 TTTCCCAAAGTGTGTTCCAGGGG - Intronic
1146392339 17:32434206-32434228 GTTCTCAAAGTATGGTCTGGGGG - Intergenic
1146909556 17:36639776-36639798 GTTCTCCAAGTGTGGTTCCCTGG + Intergenic
1147324127 17:39662336-39662358 GATCTCAAGGTGGGGTGCTGGGG + Exonic
1149314618 17:55427276-55427298 GTTCTCACAATGTGGTGCAGAGG + Intergenic
1149864419 17:60142717-60142739 CTTCTCCAGGTGTGGCCCTGGGG - Intergenic
1149917929 17:60628838-60628860 GTTCTCAAAATGTGGTTTAGGGG - Intronic
1150153825 17:62833743-62833765 GTTCTCAAAGTATGGTCCATGGG - Intergenic
1150552296 17:66221876-66221898 CTGCTCAAAATGTGGTCCAGGGG + Intronic
1151179856 17:72319470-72319492 GTTCTAACAGTGTGGTCCCTGGG - Intergenic
1151448857 17:74185200-74185222 CTACTCAAAGTGTGGTCCGAGGG - Intergenic
1151659589 17:75511855-75511877 GTCCTCAAAGTGAGGCCCTCAGG - Intronic
1153398363 18:4651527-4651549 GAACTCAAAGTGTGGCCATGTGG + Intergenic
1153502964 18:5767643-5767665 CCACTCAAAGTGTGGTCCAGGGG + Intergenic
1153560218 18:6363989-6364011 ATTCTCAAACTGTGGTCCAAGGG + Intronic
1155518488 18:26645763-26645785 GTTCTCAAAGTGCGGTCCCTCGG + Intronic
1156177355 18:34562646-34562668 GTACTCAAAGTGTGATCCCCTGG + Intronic
1156520492 18:37718059-37718081 CTTCTCATAGTGCTGTCCTGAGG + Intergenic
1156576575 18:38323910-38323932 TTTCCCAAAGTGTAGTCCTCAGG + Intergenic
1156987438 18:43364878-43364900 GTTTTCTGACTGTGGTCCTGGGG - Intergenic
1157035951 18:43974033-43974055 CTACGCAAAGTGTAGTCCTGTGG + Intergenic
1157104342 18:44759147-44759169 GTTATCAAAATGTGCTGCTGTGG + Intronic
1157790728 18:50528747-50528769 GTTCTCAAAGTGCAGTCCCCAGG - Intergenic
1158164734 18:54527810-54527832 GTTCTCAAACTGTTGACCTCTGG + Intergenic
1158950353 18:62488615-62488637 GTTCTCAAAGTGTGATGCTATGG + Intergenic
1159776059 18:72604129-72604151 TTCCTCAAAGTGTGGTTCAGTGG + Intronic
1159815268 18:73065762-73065784 GTTCTCCATGTGTGCTCCTAGGG + Intergenic
1160033797 18:75283301-75283323 GTTCTTAAAGTGGGGTCCCTGGG + Intronic
1161078803 19:2300369-2300391 GTCCTCATGCTGTGGTCCTGGGG + Intronic
1161334334 19:3704329-3704351 GCTCTCAAGGTGTGGTCCCTGGG + Intergenic
1162193482 19:8965470-8965492 GTTTCCAAAGTGAGTTCCTGGGG + Exonic
1163236076 19:16031451-16031473 GTGCTCAAAGTCCGTTCCTGTGG - Intergenic
1163432952 19:17279106-17279128 GTTCTCAAACTGGGTTCCTTGGG + Exonic
1164228532 19:23267445-23267467 GTTCTCAAACTCTGGACCTCAGG - Intergenic
1164279917 19:23760129-23760151 GTTAACAAAGTGTGGAGCTGGGG + Intergenic
1165357850 19:35314905-35314927 GTTCTCAAAGTGTGGTCCCTAGG + Intergenic
1165886473 19:39082626-39082648 GTTCTCAAAATGTGGTCTGGGGG + Intergenic
1167034026 19:46982691-46982713 GTTCTCCAAGTGTGGTTCGCTGG + Intronic
1167209705 19:48126272-48126294 GTTCTCAAACTGTTGTCTTGAGG + Intronic
1167450298 19:49563926-49563948 GTTCTCAAAGTGTGGGTCCTAGG + Intronic
924987360 2:284365-284387 CTTCTCAAAGTGTGGTCCCATGG - Intronic
925550066 2:5064110-5064132 CTTCTCAAAGTTTGCTCATGTGG - Intergenic
925872869 2:8285847-8285869 GTATTCAAAGTGTGGTCCTTGGG - Intergenic
926004867 2:9365850-9365872 GGGCTCAGAGTGTGCTCCTGAGG + Intronic
926125400 2:10268598-10268620 ATTCTCAAAGTGTGGCTCAGGGG + Intergenic
926157814 2:10467400-10467422 GTTCTAGAAGTGGGGTGCTGCGG + Intergenic
926256145 2:11202177-11202199 GCTCTCAAAGTATGGTCTGGGGG + Intronic
927493752 2:23538281-23538303 TTTCTCAAAGTGTGGTCCTTAGG - Intronic
928181049 2:29068920-29068942 ATTCTCAAAGTGTAGTCTGGGGG + Intronic
928322393 2:30294316-30294338 GTTCTCAGAATGTGGTCTTCAGG + Intronic
929141552 2:38670982-38671004 GGTGTCACAGTGTGGTCCTTGGG + Intronic
929210138 2:39346979-39347001 GTTCTCAAAGTGTGATCTGGAGG + Intronic
929397992 2:41545562-41545584 TTTCTGCAAGTGTGGTCTTGAGG - Intergenic
929985633 2:46728909-46728931 GTTCTCAAAGTGTGGTACCAGGG + Intronic
930332599 2:50004933-50004955 CTTCTCAAACTGTGGATCTGTGG - Intronic
930712806 2:54565007-54565029 GTTCTCAAAATGAGGTCCCCAGG + Intronic
930773298 2:55149349-55149371 GTTCCCAAAGAGTGGTCCTTGGG + Intergenic
931118098 2:59186293-59186315 GTTCTCAAAGTGTGGTCCTGGGG + Intergenic
931678409 2:64721047-64721069 GCTTCCAAAGTGTGGTCTTGTGG + Intronic
931700124 2:64902561-64902583 GTTCTCAAAGTGTAATCCCTGGG - Intergenic
932158333 2:69438102-69438124 GTTCTCAAAGTGCGGACTAGGGG + Intergenic
932463437 2:71897991-71898013 GTTCTGAATGTGTGCTCCGGTGG - Intergenic
933239735 2:79906716-79906738 TTTCCCAAAGTGTGTTCCTTGGG + Intronic
933496380 2:83054823-83054845 GTTTTCTAAGTCTGGTCCTCTGG + Intergenic
933616761 2:84489917-84489939 GTTCTCAAAGTGTGTTCCCTGGG - Intergenic
934609123 2:95721705-95721727 GTTCTCAAAGCGTTGTCCCTGGG + Intergenic
935383978 2:102482183-102482205 TTTCTCAGAGTCTGGTCCTCAGG + Intronic
935688779 2:105711795-105711817 GTTCTCAAAGTGTGGCCTGTGGG + Intergenic
935870582 2:107444188-107444210 GTGCTCTAAGGGTGCTCCTGTGG - Intergenic
936542444 2:113363286-113363308 GTTCTCAAAGTGTGGTCCCTGGG + Intergenic
936668161 2:114622556-114622578 GTTCTCAATGTGTGTTCTTCAGG + Intronic
937437253 2:121890595-121890617 CTTCTCAAGGTGTGGTCCTGGGG - Intergenic
937670900 2:124536322-124536344 GTTCTCAAAGTATGGCCCCCAGG + Intronic
938242681 2:129755523-129755545 GTTCTCAAAGTGTGGTCCCCAGG + Intergenic
938380722 2:130835132-130835154 GTTCTCTAAGTGTGGTCCCAGGG + Intergenic
939823191 2:146982029-146982051 GTTCTCAAACTATGGACCTAGGG - Intergenic
940561609 2:155304281-155304303 GTTCTTACAGTGTGTTTCTGTGG - Intergenic
941188499 2:162346363-162346385 GTTCTCAAATTATGGGACTGGGG - Intronic
941688237 2:168469822-168469844 TTTCTCAAAGTGTGGTCTTCTGG - Intronic
942232423 2:173872849-173872871 GTTCTCAAAGTGTGGTCCTTGGG + Intergenic
942364367 2:175208025-175208047 GTTCTCAAACTGTGGTTCCCTGG - Intergenic
943461533 2:188174851-188174873 CTTTTCAAAGTGTGGTCTTCAGG - Intergenic
943668637 2:190636974-190636996 GTTCTCCAAGTGTGGTCTAGGGG + Intergenic
945446067 2:209940062-209940084 GTTCTCAAAATGTGGTGCTTGGG - Intronic
945624949 2:212191290-212191312 GTTCTCAAAGTGTAGTCCCCAGG - Intronic
945760879 2:213913408-213913430 GTTCTCAAACTTTTGGCCTGAGG + Intronic
947083726 2:226427631-226427653 CTACTCAAAGTGTGATCCTTTGG - Intergenic
947140339 2:227014361-227014383 GTTCTCAACGTGTGGTTCCTGGG - Intronic
947352043 2:229256402-229256424 GTTGACAAACTGTGGGCCTGAGG - Intronic
947554366 2:231077043-231077065 ATTTTCAAAGTCTGGTCCTTAGG - Exonic
947805649 2:232966192-232966214 GCTCTCAGAGTGGGGCCCTGTGG + Intronic
948611292 2:239168780-239168802 GCCCTCAGAGTGTGGTCTTGTGG - Intronic
1169055767 20:2619509-2619531 TTTCTCAAAGTGTGTTTGTGCGG - Intronic
1169559330 20:6782723-6782745 GTACTCAATCTGTGGTCCTTTGG - Intergenic
1169650312 20:7859417-7859439 GCTCTCAAAGTGTAGTCATAAGG + Intergenic
1169702957 20:8469070-8469092 CTACTCAAAGTGTGGTCCATAGG - Intronic
1169743827 20:8922832-8922854 GTTCTCAAAGTTTGGTCCATGGG - Intronic
1170092779 20:12609613-12609635 GTTCTGGAAGTGTGGATCTGAGG - Intergenic
1170412063 20:16102789-16102811 GTTCACAAAGGGTGGTCATCGGG - Intergenic
1170633169 20:18082503-18082525 CTTCTCAATATGTGGTCCTCAGG + Intergenic
1170816156 20:19716178-19716200 GTTCTCAGAGGGTGGTTTTGGGG - Intronic
1172098667 20:32473093-32473115 GCTCTCAAAGGGTGGTCATGAGG + Intronic
1172144088 20:32744080-32744102 GGTCTCAAAGTGTAGTCCCTGGG - Intergenic
1172277506 20:33687714-33687736 GTTCTGCAAGGGTGGTCCTTAGG + Intergenic
1172391423 20:34567895-34567917 GGCCTCTAAGTGGGGTCCTGAGG - Intronic
1172885207 20:38226373-38226395 CTACTCAAAGTGTGGTCCATGGG + Intronic
1173300456 20:41797782-41797804 GTTCTCAAAGAGTGGTCCCTGGG - Intergenic
1173446329 20:43122180-43122202 GTTTTCATAGTGTGGTCCCTGGG - Intronic
1173843830 20:46175670-46175692 GTTCTCAAAGTGCGGCCCCTGGG + Intronic
1174565340 20:51460800-51460822 TTTCTCAAAGTGTGGCTCTCAGG + Intronic
1174797165 20:53531781-53531803 CTTCTCAAAGTGTGGTCCCTGGG + Intergenic
1175104569 20:56605501-56605523 GTGCTCAAAGTGTGATCCCCAGG + Intergenic
1175308158 20:57992187-57992209 CTACTCAAAGTGTGGTCCCCAGG + Intergenic
1175498816 20:59434650-59434672 GTTCTCAAAGTGTGGCACCTGGG + Intergenic
1176014208 20:62920615-62920637 GTTCTCAAAGCGTGGTCCAGGGG + Intronic
1176312716 21:5161783-5161805 GTTCTCAGAGTGTGGCTCTCAGG + Intergenic
1177187579 21:17814920-17814942 GTCCTCAAAGTGTGTTTCTCAGG + Intronic
1177226217 21:18260388-18260410 GTTCACTAAGTATGGTCCTATGG + Intronic
1178259012 21:31081545-31081567 GTTCTCAAAGTGTGGTCTCCTGG + Intergenic
1178583544 21:33855332-33855354 GTTGTCAAAGCGTGGTCCCCAGG - Intronic
1179148327 21:38788542-38788564 GTTCTCAATGTGTGGTCCAGAGG + Intergenic
1179171892 21:38979631-38979653 GAGGTCAAAGGGTGGTCCTGGGG - Intergenic
1179175858 21:39007575-39007597 GTCCTCAAGGTGTGCTCTTGGGG + Intergenic
1179539765 21:42076502-42076524 GTTCTCAAAGTGGGGTCCCTGGG - Intronic
1179640942 21:42746836-42746858 GTTCTAAAAATGTACTCCTGGGG - Intronic
1179844332 21:44100247-44100269 GTTCTCAGAGTGTGGCTCTCAGG - Intronic
1181011786 22:20045087-20045109 GTTCTCCAGGTGTGGTCCTTGGG + Intronic
1182340649 22:29617801-29617823 CTATTCAAAGTGTGGTCCTTGGG - Intronic
1182869589 22:33634365-33634387 GTTCTCAAAGTATGGTCCCTGGG - Intronic
1183070275 22:35391186-35391208 GTTCTCAAAGTGTGGTACCCTGG + Intronic
949158437 3:853557-853579 GTTCTCAAAGTGGGGGAATGAGG + Intergenic
949325438 3:2858178-2858200 TTTCTCAGAGTGTGGTCTTCAGG + Intronic
949332791 3:2940808-2940830 CTTCTGAAAGTCTGGTCATGGGG + Intronic
949391912 3:3572024-3572046 GTTCTTAAAATGTGGTCGTTGGG + Intergenic
949817441 3:8073430-8073452 TTTTTCAAAATGTGGTCCAGAGG - Intergenic
950080971 3:10221879-10221901 GTTCTCAGTGTTTGCTCCTGGGG + Intronic
950295986 3:11831304-11831326 ATTCTCAAAATGTGGTCCCTGGG - Intronic
950671219 3:14526843-14526865 ATTCTCAAAATGTGGTCCCCAGG + Intronic
951357822 3:21690676-21690698 GTTCTCAAAGTATGATCCCCAGG + Intronic
951496465 3:23333160-23333182 GTTTTCAAACTGTGTTCCAGGGG + Intronic
951619225 3:24582851-24582873 CTACTCAAAGTGTGGTCCGTGGG - Intergenic
951650917 3:24950825-24950847 TTTTTCAAAGTGTGGTCCCTGGG + Intergenic
952102026 3:30025470-30025492 CTACTCAAAGTGTGGTAATGAGG - Intergenic
952321987 3:32286358-32286380 GTGCACAAACTGTGGACCTGAGG - Intronic
953482761 3:43265516-43265538 GTTCTCAAAGTGTGGGCCTTGGG + Intergenic
955209751 3:56929581-56929603 GTTCTCAAAGTGTGGTCCATGGG - Intronic
955583033 3:60445265-60445287 ATTCTCAAAATGTGGTCCTCAGG - Intronic
955728825 3:61961734-61961756 ATTCTCAAATTGTGGTCCCTGGG + Intronic
956452496 3:69388349-69388371 GCTCTCAAAGTGTGGTCACTGGG + Intronic
956505498 3:69934142-69934164 GTTCTCAAAGTGTGATCAGAGGG + Intronic
956826138 3:72997811-72997833 CTTCTCGAAGTGTGGTCCGGGGG - Intronic
957080513 3:75632328-75632350 GTTATCAAAGGGTGGAGCTGGGG - Intergenic
957234344 3:77565529-77565551 GTTCTCACAGTGTGGTTCCTGGG + Intronic
957824247 3:85419984-85420006 TTTTTCAAACTGTGTTCCTGAGG - Intronic
958434704 3:94082245-94082267 TCCCCCAAAGTGTGGTCCTGGGG + Intronic
959593067 3:108100295-108100317 GTTCTCAAAGGATGCTACTGGGG + Intergenic
960639411 3:119811909-119811931 GTTCTGAAAGTGTGGTCCCTGGG + Intronic
960714774 3:120564097-120564119 TTTCTCCAAGTCTGGTCCTCTGG + Intergenic
960854651 3:122090843-122090865 GCTCTCAAAGCGTGGTCCTTAGG + Intronic
961145927 3:124593325-124593347 GTTCTCAAAGTGTGGTCACCTGG + Intronic
961173712 3:124817201-124817223 CTTCTTGCAGTGTGGTCCTGTGG + Intronic
961208997 3:125110678-125110700 GTTCTCAAAGTGTGGTCTCTGGG - Intronic
962374504 3:134849085-134849107 GTTCTCAAAGTGTGGTGCTTGGG + Intronic
962488219 3:135865426-135865448 GATCTCAAAGTGTGATCTAGGGG - Intergenic
963297348 3:143560242-143560264 CTCCTCAAAGTGTGGTCCAAGGG - Intronic
963739993 3:149068912-149068934 GTTTTCAAAGTGTGGTCCACAGG + Intronic
963956645 3:151261554-151261576 GTTCTCAAAGTGTGGTTCCTGGG + Intronic
965507467 3:169532288-169532310 GTTCTCAAAGCGTGATCCCTGGG - Intronic
965925402 3:173972778-173972800 GTTCTCAAAGTGTGGTCCCCAGG + Intronic
965925479 3:173973913-173973935 GTTCTCAAGGTGTAGTCATTAGG - Intronic
966541723 3:181099166-181099188 GTTCTCAAAGTGTGGTTGCTGGG + Intergenic
966580562 3:181557663-181557685 CTTCTCAAAGTATGGTCCTCAGG + Intergenic
966685517 3:182690249-182690271 GTTCTCAAAGTGTAGTCTCCAGG + Intergenic
967017325 3:185494055-185494077 TTTCTCAAAGTGTGGGCTTTGGG - Intronic
967093436 3:186154773-186154795 GTTCTCAAAGTGTGGCTCATAGG + Intronic
967308404 3:188082483-188082505 TTTCTCAAAAGGTTGTCCTGAGG - Intergenic
967948473 3:194822605-194822627 GTTCGTAGAGGGTGGTCCTGAGG - Intergenic
968193696 3:196689771-196689793 CTTCTCAAAGTGTGGTCTGGGGG + Intronic
968553117 4:1234138-1234160 TTTCGCAGTGTGTGGTCCTGTGG - Intronic
969414283 4:7048481-7048503 GTTCTTAAAGTGGGGTCCCACGG - Intronic
969847726 4:9932744-9932766 GTTCTAAAAGGGTGGTTGTGGGG - Intronic
970107875 4:12605313-12605335 GTTCTCAAAGTGTGGTCTCTGGG + Intergenic
970433436 4:16010408-16010430 GTTCTCAAAATATTATCCTGAGG + Intronic
970545159 4:17121926-17121948 GTTCTCAAAGTGTGGTTCCCTGG + Intergenic
972533254 4:39978432-39978454 GTTCTCAAGGTATGGTCTTTGGG + Intergenic
972927217 4:44024885-44024907 GTTCTCAAAATGTAGTCCCTTGG - Intergenic
973747294 4:53976442-53976464 CTACTCAAAGTGTGATCCTTTGG - Intronic
974465361 4:62248693-62248715 GTTCTCAAAGTGTGTTTCTCAGG - Intergenic
974600042 4:64067241-64067263 GTTCTGAAAGTGAGGTTCTTAGG + Intergenic
974640270 4:64621460-64621482 GGTCTCAAACTGTTGACCTGAGG + Intergenic
975837828 4:78442874-78442896 GTTCTCTAAGTGTGGTCCTTGGG - Intronic
976164712 4:82241998-82242020 ATTCTCAAAGTTTGGTCCTTGGG + Intergenic
976195543 4:82528414-82528436 GTTCTCAAAGTGTGGTCCCCAGG - Intronic
976218027 4:82732867-82732889 GTTCTCAAAGTGTGATTCCCAGG + Intronic
976285535 4:83367240-83367262 GTTTTCCAAGTCTGGTCCTCAGG + Intergenic
976304400 4:83545328-83545350 CTACTCAGAGTGGGGTCCTGAGG + Intronic
976344758 4:83987802-83987824 CTACTGAAAGTGTGGTCCTTGGG + Intergenic
976714042 4:88104348-88104370 GTTCTCAAAGTTTTGTTCAGGGG - Intronic
977630270 4:99234947-99234969 TTTCTCAAAGTATGGTCCTGGGG - Intergenic
980808537 4:137844858-137844880 ATTCTCAATGTGTAGTCCAGTGG + Intergenic
981093017 4:140752841-140752863 GGTCTCAAAGTGTGGTCATCAGG - Intronic
981517073 4:145620925-145620947 GTTCTCAAAGTGTAGTCCCCAGG - Intronic
981828509 4:148973114-148973136 GTTCTCCAACTGTGATACTGGGG + Intergenic
982007765 4:151079729-151079751 GTTCTCAAAATGTGGTAATAGGG - Intergenic
982073716 4:151718193-151718215 ATTCTCAAAGTGTGGTCCCCAGG - Intronic
982174598 4:152693963-152693985 GTTCTCAAAGGATGGTTCTTTGG + Intronic
983516791 4:168665785-168665807 CTCCTCAAAGTGTGGTCCTGAGG - Intronic
983642078 4:169952270-169952292 GTTCTCAAAGTGAGGTCCTCAGG + Intergenic
984252195 4:177348265-177348287 GTTCTCAAAGTCAAGTCCTCAGG - Intronic
985450403 4:190058887-190058909 GTTATCAAAGGGTGGAGCTGGGG + Intergenic
985714773 5:1449414-1449436 GTTCTCAAAGTGTGGTTCCTGGG - Intergenic
987062245 5:14253696-14253718 ATTCTCAAAGTGTGGTCCCAGGG + Intronic
987087235 5:14482279-14482301 GTTCTCAAAGTGTGGTCCCTGGG - Intronic
987143349 5:14967182-14967204 CTTGTCACAGTGTGGTCCTCGGG + Intergenic
987562023 5:19536798-19536820 GCTCTCAAAGTGTGTTCCATGGG - Intronic
989358438 5:40571664-40571686 GTTCTCAAAGTGTGGTCCCAAGG + Intergenic
989684372 5:44067875-44067897 ATTCTCCAAGTGTGGTCCTCAGG - Intergenic
990389205 5:55301385-55301407 TTTCTCAAAGTGTGCTCAGGAGG - Intronic
991534916 5:67658775-67658797 TTTCACAAAATGTGGTCCTTGGG - Intergenic
991581498 5:68160242-68160264 GTTCTCAAAGTGTAGTCTTTGGG - Intergenic
991597178 5:68317535-68317557 GTTCTCAAAGTGTGGTTTCCTGG + Intergenic
994266716 5:97725345-97725367 TTTCTCAAAATGTTGTCCTAGGG - Intergenic
994657133 5:102607810-102607832 GTTCTCAAAGTATGATCTTCAGG - Intergenic
995663585 5:114514258-114514280 CTACTCAAAGTGTGGTCCTCAGG - Intergenic
995856391 5:116597358-116597380 GTTCTCAATGTGTGGTCCCTGGG - Intergenic
996465640 5:123799450-123799472 ATTCTCAAAATGTGGTCCCTGGG - Intergenic
997407815 5:133665869-133665891 TTGCTCAAAGGCTGGTCCTGGGG + Intergenic
998202054 5:140132783-140132805 GTTCTCAAAGTGTAGCCCCTGGG + Intergenic
998390029 5:141781310-141781332 GTTCTCAGAGTGTAGTACTCGGG - Intergenic
999492980 5:152069846-152069868 GTGCTCAAAGTGTGTTACAGGGG + Intergenic
999881210 5:155866492-155866514 GTTCTCAAAGTGTGGTCTACAGG - Intergenic
1000182017 5:158820875-158820897 GGTCTCAAACTGTTGACCTGTGG + Intronic
1000989312 5:167895730-167895752 GTTCTCAAAATGTGGGCCCCAGG - Intronic
1002060618 5:176623591-176623613 GGTCACAAGGTGGGGTCCTGGGG + Intronic
1002301408 5:178259406-178259428 GTTCTCAAAGTGTGGTCCTGGGG - Intronic
1002351230 5:178585140-178585162 GTTCCCAAAATGTGGTCCTTGGG + Intronic
1003120591 6:3316139-3316161 GTTCTCAAAGTGCAGTCCCTGGG - Intronic
1003146169 6:3512396-3512418 GGTCTCAAAGTCTGCTTCTGAGG + Intergenic
1003492540 6:6636153-6636175 GTTCTCAAAGTGTGGTCCCTGGG - Intronic
1003830149 6:10000528-10000550 GTTCTCAAAGTATGGTCCCTGGG + Intronic
1003951085 6:11116233-11116255 GTTCTCAAACTCTGGGCCTCAGG + Intronic
1004557489 6:16713671-16713693 TCACTTAAAGTGTGGTCCTGGGG + Intronic
1004748061 6:18532372-18532394 ATTCTCAAAATGTGGTCCCCAGG - Intergenic
1004819651 6:19353507-19353529 GTTCTCAAACTCTGGACCTCAGG - Intergenic
1006056610 6:31389738-31389760 GTTCTCAAAGTGTGGTCCTGGGG + Intergenic
1006069334 6:31486717-31486739 GTTCTCAAAGTGTGGTCCTGGGG + Intergenic
1006376091 6:33672375-33672397 GTTCCCACAGTGTGGTTCTTGGG + Intronic
1006686753 6:35841347-35841369 TTTCTCAAAATGTGGTCTTCTGG - Intronic
1006855745 6:37132000-37132022 TCTCACATAGTGTGGTCCTGAGG + Intergenic
1007108601 6:39299989-39300011 GTTCTCAAAGTGTGGTCCCTGGG + Intronic
1007270564 6:40633285-40633307 GTTCTCAAAGCATGGTCCAGGGG + Intergenic
1007497916 6:42274085-42274107 GTTCCCAAAGTGTGGTTCTTGGG + Intronic
1008040743 6:46795855-46795877 ATTCCCAAAGTGTGGTCCACAGG + Intronic
1008334913 6:50291230-50291252 TTCCTCAAAGTGTGGTCCCCAGG + Intergenic
1009449531 6:63785076-63785098 GTTCTCAAAATGTGGTCCCTGGG - Intronic
1009658034 6:66570758-66570780 ATTCTCAAAGTGTGGTCTATGGG + Intergenic
1010576107 6:77532850-77532872 GTTCTAAATGAGTGGTGCTGTGG + Intergenic
1011183179 6:84644622-84644644 CTTCTCAAAGTGTGGTCGGAAGG + Intergenic
1011480915 6:87792771-87792793 GTTCTCAAAATGTGGTCCATGGG + Intergenic
1011716506 6:90111201-90111223 GTTCTCAAAGTGTGGTCTGTGGG - Intronic
1011727573 6:90225926-90225948 GTTCTCCAAGCGGGGTCCTAAGG + Intronic
1013049958 6:106523215-106523237 GTTCTCAAAATGTGGTTCAGAGG - Intronic
1013682172 6:112536450-112536472 ATTCTCAAAGTGTGGTCCCTGGG + Intergenic
1014207068 6:118667486-118667508 GTTTTCAAACTGTGCTCCTAGGG + Intronic
1014263017 6:119241416-119241438 GTTCTCAAAGTGTGGTCGTTGGG + Intronic
1015950128 6:138544579-138544601 GTCCTCAAAGTCTGTTCATGAGG - Intronic
1017909859 6:158783341-158783363 CCTCTCAAAGGGTGGTCCAGAGG - Intronic
1017964731 6:159254265-159254287 TTTCTCAAGGCTTGGTCCTGGGG + Intronic
1018388257 6:163323651-163323673 GTTCTCAAAGTGGGCTCCCGGGG + Intergenic
1021197043 7:17685479-17685501 GTTCTAAAAGTGGGGTGCTATGG - Intergenic
1021666054 7:22981618-22981640 CTTCGGAAAGTGTGGTCCTGAGG + Intronic
1021750150 7:23790104-23790126 CTTCTCAAAGTATGGTCCAAGGG - Intronic
1022216128 7:28263483-28263505 GTTCTCAAAGTGTGGTATGAGGG - Intergenic
1022334131 7:29406642-29406664 GTTCTCAAAGCATGGCCCTCGGG + Intronic
1023475951 7:40578154-40578176 ATTCTCAAAGAATGGTCCTACGG - Intronic
1024305945 7:47929667-47929689 GTTCTCAGAGTGGGGTCCCAGGG + Intronic
1024618180 7:51133458-51133480 GTTCTCAAAGTGGGGTTCACCGG + Intronic
1024764367 7:52639558-52639580 TTTCTTAAAGTGAGGTCATGAGG - Intergenic
1025107214 7:56181644-56181666 GTTCTCAACGTGTGGTCTTCAGG - Intergenic
1025854441 7:65265197-65265219 GTTATCAAAGGGTGGAGCTGGGG - Intergenic
1026084212 7:67249575-67249597 GTTCTGAAAGTGTGGTCTCTGGG - Intergenic
1026133630 7:67640788-67640810 GTGCTCACTGTGTGTTCCTGGGG - Intergenic
1026311038 7:69184573-69184595 GTTCTCAACGTGTGGTCCTCGGG + Intergenic
1026610467 7:71855185-71855207 GTTCTCCAAGTGTGGTCTATGGG + Intronic
1026692871 7:72564766-72564788 GTTCTGAAAGTGTGGTCTCTGGG + Intronic
1027133169 7:75605750-75605772 GTTCTCAAACTCCTGTCCTGAGG + Intronic
1027499087 7:78925504-78925526 GGTCTCAAAGTGTGGCCTAGGGG + Intronic
1027899119 7:84086221-84086243 GTTCTCAATTTGTGCTGCTGTGG - Intronic
1028450125 7:90972836-90972858 GTTCTCAAAATCAGGTACTGAGG - Intronic
1028920155 7:96302049-96302071 ATTCTCAAATTTTGCTCCTGTGG - Intronic
1029321474 7:99764554-99764576 GTATTCAAAGTGTGGTCCATGGG + Intronic
1030079422 7:105764355-105764377 GTTCTCAAAGTATAGTCCCAGGG + Intronic
1032386408 7:131528569-131528591 GTTCTCAAAGTGTGGTCCTCTGG - Intronic
1032913571 7:136461766-136461788 GTTCTCAAAGTGTGGGCATCAGG - Intergenic
1033248296 7:139736948-139736970 GTTCTCAAAAGGTGGTCAAGGGG + Intronic
1033254131 7:139784941-139784963 TTTCTCAAAGTGTGGTCCTTGGG + Intronic
1033397573 7:140990506-140990528 CTGCTCAAAGTGTGGTCCCCAGG - Intergenic
1033422007 7:141211920-141211942 ATTCTCAAAGTGTGGTCCCAGGG - Intronic
1034837764 7:154368305-154368327 GTTCTCAAAGTGTGCTCCCCGGG + Intronic
1034948004 7:155276522-155276544 CTTCTCAAAGTGGGGTCCACAGG + Intergenic
1034986410 7:155518164-155518186 GTGCTCAAAGGGTGGTCCTTGGG + Intronic
1035325243 7:158061716-158061738 GTCCTTCAGGTGTGGTCCTGGGG - Intronic
1037056282 8:14445600-14445622 ATTCTCAAAGGGTGGTAATGGGG - Intronic
1037740282 8:21603386-21603408 TTACTCAAAGTGTGGTCCATAGG + Intergenic
1037791121 8:21943136-21943158 GTTCCCAAAATGTGGTCCATGGG - Intronic
1038408756 8:27342086-27342108 GTTCTCAAAGTGGGGTTCCCAGG - Intronic
1039817666 8:41108845-41108867 GTTCTCAGAGAGTTGTCCAGAGG - Intergenic
1040370350 8:46764784-46764806 GTTCTCAAAGTGTGTTCCCCGGG - Intergenic
1040622471 8:49105389-49105411 GATCTCAAGGTGGGGTCCAGAGG + Intergenic
1041129042 8:54677016-54677038 GTTTTCAAAGTGTGGTTCGTAGG + Intergenic
1041589154 8:59556768-59556790 GGTCTCAAAGTGTGGTCTGGGGG - Intergenic
1042327381 8:67542210-67542232 TTTCATAAAGTGTGGTCCTCAGG - Intronic
1042721832 8:71834473-71834495 GTTCTCTCAGTGTGGTCTTAGGG + Intronic
1042751596 8:72163549-72163571 GTTCTCAAAGTGTGGTTCCCTGG - Intergenic
1043389655 8:79780055-79780077 GTTCTCAATGTGTGGTCTCTGGG - Intergenic
1044772649 8:95653465-95653487 GAACTGGAAGTGTGGTCCTGTGG - Intergenic
1045420993 8:102014970-102014992 GTATTCAAAGGGTGGTCCAGGGG - Intronic
1046006574 8:108493380-108493402 GTTCTCAAAGTCTGGTCACTTGG + Intergenic
1046588106 8:116172696-116172718 GTACTCAAAGTATGGTCCAGGGG - Intergenic
1047138945 8:122113634-122113656 GTACACAAACTCTGGTCCTGGGG + Intergenic
1047376610 8:124303979-124304001 GTTCTCAAAGTGTGTTGGTATGG + Intergenic
1047403774 8:124568111-124568133 GTTCTCAAAGTGAGGTCCCCAGG - Intronic
1047862299 8:128981328-128981350 TTTCTCAAAGTGTGGTCCTCTGG + Intergenic
1048086335 8:131184906-131184928 GTTCTCAAAAAGTGGTCCTTGGG - Intergenic
1048329654 8:133463222-133463244 ATTCTCAAAGTGGGGTCCCCCGG - Intronic
1049941986 9:555086-555108 GTTCTCAAAGTGTGGTCGCTAGG - Intronic
1050002670 9:1095111-1095133 ATTTTCAAAGTGTGGTCCTTGGG - Intergenic
1050189911 9:3013939-3013961 GTTCTCAAAATGTGGTCACCAGG - Intergenic
1051549481 9:18313217-18313239 GTTCTCAAAGAGTTGTCTGGAGG - Intergenic
1051726632 9:20093676-20093698 GTTCTAAAAGTGTGGTCCCTTGG + Intergenic
1053469917 9:38339046-38339068 AATCTCAAAGTGTGGTCCCTGGG - Intergenic
1054239617 9:62598314-62598336 GTTCCCAATCTGTGGTACTGAGG - Intergenic
1055400471 9:75918448-75918470 GCTCTCAAAGTGTGGCCCTGGGG - Intronic
1055636978 9:78288579-78288601 GGCCTCAAAGAGTGCTCCTGTGG - Intergenic
1056007768 9:82291033-82291055 GTTTTCAAAGTTTTGTCTTGTGG + Intergenic
1056106000 9:83346871-83346893 GTCCTCAAAGTGAGGTCCCTGGG - Intronic
1056317136 9:85400937-85400959 GTGCTCACAGTGTGGCCCTTGGG - Intergenic
1056472356 9:86918307-86918329 ATTCTCCAAATGTGGTCCTCAGG + Intergenic
1057583592 9:96309548-96309570 TTTTTCAAAGTGTTGGCCTGAGG + Intergenic
1058350420 9:104014904-104014926 GTTTTCAAAGTATGGTCCCCTGG - Intergenic
1059060262 9:111028739-111028761 TTTCTCAAAGCGTGGTCTTTAGG + Intronic
1059948309 9:119435784-119435806 GTTCTCAAAGTGTGGTACTCAGG - Intergenic
1060686348 9:125616834-125616856 GTTTTCAAACCATGGTCCTGAGG + Intronic
1060908544 9:127330005-127330027 GTTCTCAAAGTGGGGGCCCTAGG + Intronic
1060921214 9:127421909-127421931 GTTCTCAAAGTGGGATCCCCAGG - Intergenic
1061837541 9:133339388-133339410 GTTCTCACAGTGTGCTGCTCTGG - Exonic
1062014727 9:134285320-134285342 CTTCTCAAGGTGTGTTCCTGAGG + Intergenic
1062194767 9:135266818-135266840 GTCCACAAAGTGGGTTCCTGAGG - Intergenic
1185510711 X:662140-662162 GTTCTGAAAGTGTGGCTCTCGGG + Intergenic
1185870364 X:3659629-3659651 GTTCAAAATGTGTGGTCTTGAGG + Intronic
1186215618 X:7297208-7297230 CCTCTCAAAGTGTGGTTCTTGGG + Intronic
1186763526 X:12747700-12747722 GTTCCCAAGGTGTGGTCCCTGGG - Intergenic
1187720956 X:22150354-22150376 ATTCTCAAAGTATGGTCCATAGG - Intronic
1188101801 X:26097235-26097257 GTTCTCAAAGTGTGATCCCTGGG + Intergenic
1188405124 X:29797949-29797971 GTTCTCAAAGTGTGGTCCCTGGG + Intronic
1188681304 X:33010843-33010865 GTTCTCAAAGTGTGGTTCTTTGG + Intronic
1188855130 X:35185406-35185428 ATTCTCTAAATGTGTTCCTGTGG + Intergenic
1189005169 X:36986585-36986607 ATACTCAAAGTGTGGTCCTTGGG + Intergenic
1189043860 X:37571357-37571379 ATACTCAAAGTGTGGTCCTTGGG - Intronic
1189856086 X:45226581-45226603 GTTCTCAAAGTGTGGTCCCCGGG + Intergenic
1196018596 X:110965482-110965504 GTTCCCAAAGCCTGGTCCTGAGG - Intronic
1196502238 X:116398566-116398588 GTTCTCAAAATGTGGTCCAGGGG + Intergenic
1197592352 X:128423808-128423830 TTTCTCAAAGTGTGGTCCCCAGG - Intergenic
1198467667 X:136917905-136917927 ATTTTCAAAGTGTGGTCTGGGGG + Intergenic
1198559128 X:137829731-137829753 ATTCTCCAAGTGTGATCCTCGGG + Intergenic
1199140051 X:144300151-144300173 GTTTTCAAAGTGTGGTCTAGAGG - Intergenic
1199683601 X:150244482-150244504 TTTCTCAAAGTGTGGTCACAGGG + Intergenic
1199804323 X:151282598-151282620 TTTCTCAAAGTGTGGTTCTGGGG + Intergenic
1199988668 X:152971004-152971026 GTTCTCATAATGTGGCCCAGAGG - Intronic
1200417817 Y:2931267-2931289 TTTCTCAAAGTGTGGTCTGAGGG + Intronic