ID: 931118099

View in Genome Browser
Species Human (GRCh38)
Location 2:59186294-59186316
Sequence TTCTCAAAGTGTGGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931118088_931118099 28 Left 931118088 2:59186243-59186265 CCCCACGCTAGTAGTCAAAAGTG No data
Right 931118099 2:59186294-59186316 TTCTCAAAGTGTGGTCCTGGGGG No data
931118091_931118099 26 Left 931118091 2:59186245-59186267 CCACGCTAGTAGTCAAAAGTGGT No data
Right 931118099 2:59186294-59186316 TTCTCAAAGTGTGGTCCTGGGGG No data
931118089_931118099 27 Left 931118089 2:59186244-59186266 CCCACGCTAGTAGTCAAAAGTGG No data
Right 931118099 2:59186294-59186316 TTCTCAAAGTGTGGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931118099 Original CRISPR TTCTCAAAGTGTGGTCCTGG GGG Intergenic
No off target data available for this crispr