ID: 931121532

View in Genome Browser
Species Human (GRCh38)
Location 2:59225588-59225610
Sequence GGCCCTAAAAATACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931121519_931121532 19 Left 931121519 2:59225546-59225568 CCAAATGTAAAAATGCCTTTCCA No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data
931121520_931121532 4 Left 931121520 2:59225561-59225583 CCTTTCCAATCCCAACCCCAGAG No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data
931121517_931121532 21 Left 931121517 2:59225544-59225566 CCCCAAATGTAAAAATGCCTTTC No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data
931121525_931121532 -6 Left 931121525 2:59225571-59225593 CCCAACCCCAGAGGCAGGGCCCT No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data
931121526_931121532 -7 Left 931121526 2:59225572-59225594 CCAACCCCAGAGGCAGGGCCCTA No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data
931121518_931121532 20 Left 931121518 2:59225545-59225567 CCCAAATGTAAAAATGCCTTTCC No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data
931121522_931121532 -1 Left 931121522 2:59225566-59225588 CCAATCCCAACCCCAGAGGCAGG No data
Right 931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931121532 Original CRISPR GGCCCTAAAAATACTGAGGA GGG Intergenic
No off target data available for this crispr