ID: 931132823

View in Genome Browser
Species Human (GRCh38)
Location 2:59357195-59357217
Sequence CTACAGGCATAGATTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931132820_931132823 15 Left 931132820 2:59357157-59357179 CCTAACTCAGTCCAGCAGAGACA No data
Right 931132823 2:59357195-59357217 CTACAGGCATAGATTGAGAATGG No data
931132821_931132823 4 Left 931132821 2:59357168-59357190 CCAGCAGAGACATGCTTAAAATC No data
Right 931132823 2:59357195-59357217 CTACAGGCATAGATTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931132823 Original CRISPR CTACAGGCATAGATTGAGAA TGG Intergenic
No off target data available for this crispr