ID: 931137636

View in Genome Browser
Species Human (GRCh38)
Location 2:59421919-59421941
Sequence TTCCTGGAATTGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931137636_931137642 -5 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137642 2:59421937-59421959 AGGAAACATGGAGTGGGGCAAGG No data
931137636_931137645 9 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137645 2:59421951-59421973 GGGGCAAGGAGAGGAGCAGGTGG No data
931137636_931137644 6 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137644 2:59421948-59421970 AGTGGGGCAAGGAGAGGAGCAGG No data
931137636_931137647 15 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137647 2:59421957-59421979 AGGAGAGGAGCAGGTGGGTCAGG No data
931137636_931137646 10 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137646 2:59421952-59421974 GGGCAAGGAGAGGAGCAGGTGGG No data
931137636_931137640 -10 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137640 2:59421932-59421954 ATTCCAGGAAACATGGAGTGGGG No data
931137636_931137643 0 Left 931137636 2:59421919-59421941 CCTGTCTGTGGCAATTCCAGGAA No data
Right 931137643 2:59421942-59421964 ACATGGAGTGGGGCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931137636 Original CRISPR TTCCTGGAATTGCCACAGAC AGG (reversed) Intergenic
No off target data available for this crispr