ID: 931140406

View in Genome Browser
Species Human (GRCh38)
Location 2:59451941-59451963
Sequence AAGCCAGCACAGGTACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931140402_931140406 -5 Left 931140402 2:59451923-59451945 CCACCCTAGCTGTGGCACAAGCC No data
Right 931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG No data
931140403_931140406 -8 Left 931140403 2:59451926-59451948 CCCTAGCTGTGGCACAAGCCAGC No data
Right 931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG No data
931140399_931140406 22 Left 931140399 2:59451896-59451918 CCGACATTACAGTGTAGCATTCT No data
Right 931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG No data
931140398_931140406 23 Left 931140398 2:59451895-59451917 CCCGACATTACAGTGTAGCATTC No data
Right 931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG No data
931140404_931140406 -9 Left 931140404 2:59451927-59451949 CCTAGCTGTGGCACAAGCCAGCA No data
Right 931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931140406 Original CRISPR AAGCCAGCACAGGTACAGCT TGG Intergenic
No off target data available for this crispr