ID: 931145768

View in Genome Browser
Species Human (GRCh38)
Location 2:59515862-59515884
Sequence GGTCTGAGCAGACAAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931145766_931145768 20 Left 931145766 2:59515819-59515841 CCACAGATCTGGAGACTTTAGTA No data
Right 931145768 2:59515862-59515884 GGTCTGAGCAGACAAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931145768 Original CRISPR GGTCTGAGCAGACAAAATGC TGG Intergenic
No off target data available for this crispr