ID: 931149203

View in Genome Browser
Species Human (GRCh38)
Location 2:59554220-59554242
Sequence CATTGTGTTAAATGCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931149203_931149204 -10 Left 931149203 2:59554220-59554242 CCTTCTTTGCATTTAACACAATG No data
Right 931149204 2:59554233-59554255 TAACACAATGCTCATATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931149203 Original CRISPR CATTGTGTTAAATGCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr