ID: 931151356

View in Genome Browser
Species Human (GRCh38)
Location 2:59577385-59577407
Sequence CTTTTATTCCACATGTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931151356_931151358 7 Left 931151356 2:59577385-59577407 CCTAAATACATGTGGAATAAAAG No data
Right 931151358 2:59577415-59577437 AAAGAAGACTTGTGTCCCTGTGG No data
931151356_931151360 17 Left 931151356 2:59577385-59577407 CCTAAATACATGTGGAATAAAAG No data
Right 931151360 2:59577425-59577447 TGTGTCCCTGTGGGCCCTCCAGG No data
931151356_931151359 8 Left 931151356 2:59577385-59577407 CCTAAATACATGTGGAATAAAAG No data
Right 931151359 2:59577416-59577438 AAGAAGACTTGTGTCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931151356 Original CRISPR CTTTTATTCCACATGTATTT AGG (reversed) Intergenic
No off target data available for this crispr