ID: 931152020

View in Genome Browser
Species Human (GRCh38)
Location 2:59585126-59585148
Sequence GGATCCAGAATGCCCCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931152017_931152020 -5 Left 931152017 2:59585108-59585130 CCTAGATATTCAACCTCAGGATC No data
Right 931152020 2:59585126-59585148 GGATCCAGAATGCCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931152020 Original CRISPR GGATCCAGAATGCCCCCTGG TGG Intergenic
No off target data available for this crispr