ID: 931154137

View in Genome Browser
Species Human (GRCh38)
Location 2:59608378-59608400
Sequence ACTAGGCAGTGCTTTAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931154137_931154144 21 Left 931154137 2:59608378-59608400 CCCCCACTAAAGCACTGCCTAGT No data
Right 931154144 2:59608422-59608444 CTGTCCTCCAGACACCAGAAAGG 0: 13
1: 490
2: 884
3: 1682
4: 1818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931154137 Original CRISPR ACTAGGCAGTGCTTTAGTGG GGG (reversed) Intergenic
No off target data available for this crispr