ID: 931155254

View in Genome Browser
Species Human (GRCh38)
Location 2:59621540-59621562
Sequence TGGGACTATGGCCAGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931155254_931155262 21 Left 931155254 2:59621540-59621562 CCAAGCCACTGGCCATAGTCCCA No data
Right 931155262 2:59621584-59621606 AAGTCATATCTGAAGAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931155254 Original CRISPR TGGGACTATGGCCAGTGGCT TGG (reversed) Intergenic
No off target data available for this crispr