ID: 931155593

View in Genome Browser
Species Human (GRCh38)
Location 2:59625089-59625111
Sequence GCCACGGATTTGAGGGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931155583_931155593 20 Left 931155583 2:59625046-59625068 CCCTCGTATGCAGTTTTGCTTGG No data
Right 931155593 2:59625089-59625111 GCCACGGATTTGAGGGTCCCGGG No data
931155585_931155593 19 Left 931155585 2:59625047-59625069 CCTCGTATGCAGTTTTGCTTGGT No data
Right 931155593 2:59625089-59625111 GCCACGGATTTGAGGGTCCCGGG No data
931155588_931155593 -7 Left 931155588 2:59625073-59625095 CCTTCAGGCAGTACAGGCCACGG No data
Right 931155593 2:59625089-59625111 GCCACGGATTTGAGGGTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931155593 Original CRISPR GCCACGGATTTGAGGGTCCC GGG Intergenic
No off target data available for this crispr