ID: 931157769

View in Genome Browser
Species Human (GRCh38)
Location 2:59654763-59654785
Sequence AGCCAGCTAATCTAGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931157769_931157770 -1 Left 931157769 2:59654763-59654785 CCTCAACACTAGATTAGCTGGCT No data
Right 931157770 2:59654785-59654807 TGACCCACCCGAGTGACATCAGG No data
931157769_931157778 30 Left 931157769 2:59654763-59654785 CCTCAACACTAGATTAGCTGGCT No data
Right 931157778 2:59654816-59654838 TGAGCCTTGGGAACAAGGACAGG No data
931157769_931157777 25 Left 931157769 2:59654763-59654785 CCTCAACACTAGATTAGCTGGCT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157769_931157775 17 Left 931157769 2:59654763-59654785 CCTCAACACTAGATTAGCTGGCT No data
Right 931157775 2:59654803-59654825 TCAGGATTTTGTGTGAGCCTTGG No data
931157769_931157776 18 Left 931157769 2:59654763-59654785 CCTCAACACTAGATTAGCTGGCT No data
Right 931157776 2:59654804-59654826 CAGGATTTTGTGTGAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931157769 Original CRISPR AGCCAGCTAATCTAGTGTTG AGG (reversed) Intergenic
No off target data available for this crispr