ID: 931157771

View in Genome Browser
Species Human (GRCh38)
Location 2:59654788-59654810
Sequence AATCCTGATGTCACTCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931157771_931157778 5 Left 931157771 2:59654788-59654810 CCCACCCGAGTGACATCAGGATT No data
Right 931157778 2:59654816-59654838 TGAGCCTTGGGAACAAGGACAGG No data
931157771_931157777 0 Left 931157771 2:59654788-59654810 CCCACCCGAGTGACATCAGGATT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157771_931157776 -7 Left 931157771 2:59654788-59654810 CCCACCCGAGTGACATCAGGATT No data
Right 931157776 2:59654804-59654826 CAGGATTTTGTGTGAGCCTTGGG No data
931157771_931157775 -8 Left 931157771 2:59654788-59654810 CCCACCCGAGTGACATCAGGATT No data
Right 931157775 2:59654803-59654825 TCAGGATTTTGTGTGAGCCTTGG No data
931157771_931157779 8 Left 931157771 2:59654788-59654810 CCCACCCGAGTGACATCAGGATT No data
Right 931157779 2:59654819-59654841 GCCTTGGGAACAAGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931157771 Original CRISPR AATCCTGATGTCACTCGGGT GGG (reversed) Intergenic
No off target data available for this crispr