ID: 931157773

View in Genome Browser
Species Human (GRCh38)
Location 2:59654792-59654814
Sequence ACAAAATCCTGATGTCACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931157773_931157777 -4 Left 931157773 2:59654792-59654814 CCCGAGTGACATCAGGATTTTGT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157773_931157778 1 Left 931157773 2:59654792-59654814 CCCGAGTGACATCAGGATTTTGT No data
Right 931157778 2:59654816-59654838 TGAGCCTTGGGAACAAGGACAGG No data
931157773_931157779 4 Left 931157773 2:59654792-59654814 CCCGAGTGACATCAGGATTTTGT No data
Right 931157779 2:59654819-59654841 GCCTTGGGAACAAGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931157773 Original CRISPR ACAAAATCCTGATGTCACTC GGG (reversed) Intergenic
No off target data available for this crispr