ID: 931157774

View in Genome Browser
Species Human (GRCh38)
Location 2:59654793-59654815
Sequence CACAAAATCCTGATGTCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931157774_931157779 3 Left 931157774 2:59654793-59654815 CCGAGTGACATCAGGATTTTGTG No data
Right 931157779 2:59654819-59654841 GCCTTGGGAACAAGGACAGGAGG No data
931157774_931157777 -5 Left 931157774 2:59654793-59654815 CCGAGTGACATCAGGATTTTGTG No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157774_931157781 30 Left 931157774 2:59654793-59654815 CCGAGTGACATCAGGATTTTGTG No data
Right 931157781 2:59654846-59654868 TAACAGCAAAAATGAGTCAGAGG No data
931157774_931157778 0 Left 931157774 2:59654793-59654815 CCGAGTGACATCAGGATTTTGTG No data
Right 931157778 2:59654816-59654838 TGAGCCTTGGGAACAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931157774 Original CRISPR CACAAAATCCTGATGTCACT CGG (reversed) Intergenic
No off target data available for this crispr