ID: 931157777

View in Genome Browser
Species Human (GRCh38)
Location 2:59654811-59654833
Sequence TTGTGTGAGCCTTGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931157768_931157777 26 Left 931157768 2:59654762-59654784 CCCTCAACACTAGATTAGCTGGC No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157772_931157777 -1 Left 931157772 2:59654789-59654811 CCACCCGAGTGACATCAGGATTT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157774_931157777 -5 Left 931157774 2:59654793-59654815 CCGAGTGACATCAGGATTTTGTG No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157769_931157777 25 Left 931157769 2:59654763-59654785 CCTCAACACTAGATTAGCTGGCT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157771_931157777 0 Left 931157771 2:59654788-59654810 CCCACCCGAGTGACATCAGGATT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data
931157773_931157777 -4 Left 931157773 2:59654792-59654814 CCCGAGTGACATCAGGATTTTGT No data
Right 931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931157777 Original CRISPR TTGTGTGAGCCTTGGGAACA AGG Intergenic
No off target data available for this crispr