ID: 931166536

View in Genome Browser
Species Human (GRCh38)
Location 2:59754989-59755011
Sequence TTCAAGAATCCTAATGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931166534_931166536 -6 Left 931166534 2:59754972-59754994 CCAAGAAGTTCTCACTCTTCAAG No data
Right 931166536 2:59754989-59755011 TTCAAGAATCCTAATGGAGTAGG No data
931166533_931166536 -2 Left 931166533 2:59754968-59754990 CCATCCAAGAAGTTCTCACTCTT No data
Right 931166536 2:59754989-59755011 TTCAAGAATCCTAATGGAGTAGG No data
931166532_931166536 26 Left 931166532 2:59754940-59754962 CCAGGTCTGCACAAAAGATCACT No data
Right 931166536 2:59754989-59755011 TTCAAGAATCCTAATGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931166536 Original CRISPR TTCAAGAATCCTAATGGAGT AGG Intergenic
No off target data available for this crispr