ID: 931168751

View in Genome Browser
Species Human (GRCh38)
Location 2:59779697-59779719
Sequence TCTGAATCAGACTCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931168751_931168759 21 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168759 2:59779741-59779763 TTCATCAGAATGAGGAGGAGGGG No data
931168751_931168755 13 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168755 2:59779733-59779755 AATAAAATTTCATCAGAATGAGG No data
931168751_931168758 20 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data
931168751_931168760 22 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168760 2:59779742-59779764 TCATCAGAATGAGGAGGAGGGGG No data
931168751_931168757 19 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168757 2:59779739-59779761 ATTTCATCAGAATGAGGAGGAGG No data
931168751_931168756 16 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168756 2:59779736-59779758 AAAATTTCATCAGAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931168751 Original CRISPR TCTGAATCAGACTCCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr