ID: 931168753

View in Genome Browser
Species Human (GRCh38)
Location 2:59779699-59779721
Sequence ACTCTGAATCAGACTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931168753_931168756 14 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168756 2:59779736-59779758 AAAATTTCATCAGAATGAGGAGG No data
931168753_931168760 20 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168760 2:59779742-59779764 TCATCAGAATGAGGAGGAGGGGG No data
931168753_931168757 17 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168757 2:59779739-59779761 ATTTCATCAGAATGAGGAGGAGG No data
931168753_931168755 11 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168755 2:59779733-59779755 AATAAAATTTCATCAGAATGAGG No data
931168753_931168758 18 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data
931168753_931168759 19 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168759 2:59779741-59779763 TTCATCAGAATGAGGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931168753 Original CRISPR ACTCTGAATCAGACTCCAGT GGG (reversed) Intergenic
No off target data available for this crispr