ID: 931168758

View in Genome Browser
Species Human (GRCh38)
Location 2:59779740-59779762
Sequence TTTCATCAGAATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931168752_931168758 19 Left 931168752 2:59779698-59779720 CCCCACTGGAGTCTGATTCAGAG No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data
931168754_931168758 17 Left 931168754 2:59779700-59779722 CCACTGGAGTCTGATTCAGAGTT No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data
931168751_931168758 20 Left 931168751 2:59779697-59779719 CCCCCACTGGAGTCTGATTCAGA No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data
931168750_931168758 21 Left 931168750 2:59779696-59779718 CCCCCCACTGGAGTCTGATTCAG No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data
931168753_931168758 18 Left 931168753 2:59779699-59779721 CCCACTGGAGTCTGATTCAGAGT No data
Right 931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931168758 Original CRISPR TTTCATCAGAATGAGGAGGA GGG Intergenic
No off target data available for this crispr