ID: 931174743

View in Genome Browser
Species Human (GRCh38)
Location 2:59842393-59842415
Sequence GTGGATAAACAGATCTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931174743_931174747 -2 Left 931174743 2:59842393-59842415 CCAGGCTAGATCTGTTTATCCAC No data
Right 931174747 2:59842414-59842436 ACGTCAACTTACAATTAGAGGGG No data
931174743_931174745 -4 Left 931174743 2:59842393-59842415 CCAGGCTAGATCTGTTTATCCAC No data
Right 931174745 2:59842412-59842434 CCACGTCAACTTACAATTAGAGG No data
931174743_931174748 30 Left 931174743 2:59842393-59842415 CCAGGCTAGATCTGTTTATCCAC No data
Right 931174748 2:59842446-59842468 TGAGCTTCAGATATATTGTCTGG No data
931174743_931174746 -3 Left 931174743 2:59842393-59842415 CCAGGCTAGATCTGTTTATCCAC No data
Right 931174746 2:59842413-59842435 CACGTCAACTTACAATTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931174743 Original CRISPR GTGGATAAACAGATCTAGCC TGG (reversed) Intergenic
No off target data available for this crispr