ID: 931175510

View in Genome Browser
Species Human (GRCh38)
Location 2:59850585-59850607
Sequence ATGGCCAGGCTTACCTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931175506_931175510 3 Left 931175506 2:59850559-59850581 CCTATATTGTATTGTTCCATCAT No data
Right 931175510 2:59850585-59850607 ATGGCCAGGCTTACCTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931175510 Original CRISPR ATGGCCAGGCTTACCTTGTT AGG Intergenic
No off target data available for this crispr