ID: 931176307

View in Genome Browser
Species Human (GRCh38)
Location 2:59858500-59858522
Sequence CCCTGGGGCCATGTGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931176307_931176314 29 Left 931176307 2:59858500-59858522 CCCTCAGACACATGGCCCCAGGG No data
Right 931176314 2:59858552-59858574 CTTCTTATGAGTTCTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931176307 Original CRISPR CCCTGGGGCCATGTGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr