ID: 931179576

View in Genome Browser
Species Human (GRCh38)
Location 2:59885895-59885917
Sequence TTTCACATGCTGCAACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931179571_931179576 29 Left 931179571 2:59885843-59885865 CCTCCGGGAAATTTCATCCACGC No data
Right 931179576 2:59885895-59885917 TTTCACATGCTGCAACAACCAGG No data
931179570_931179576 30 Left 931179570 2:59885842-59885864 CCCTCCGGGAAATTTCATCCACG No data
Right 931179576 2:59885895-59885917 TTTCACATGCTGCAACAACCAGG No data
931179574_931179576 12 Left 931179574 2:59885860-59885882 CCACGCATTCACAGAGGCATTGG No data
Right 931179576 2:59885895-59885917 TTTCACATGCTGCAACAACCAGG No data
931179572_931179576 26 Left 931179572 2:59885846-59885868 CCGGGAAATTTCATCCACGCATT No data
Right 931179576 2:59885895-59885917 TTTCACATGCTGCAACAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931179576 Original CRISPR TTTCACATGCTGCAACAACC AGG Intergenic
No off target data available for this crispr