ID: 931188096

View in Genome Browser
Species Human (GRCh38)
Location 2:59973284-59973306
Sequence CCTCATCTGTAAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931188096_931188103 6 Left 931188096 2:59973284-59973306 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 931188103 2:59973313-59973335 AGATGCAGATTACTTAGCTGGGG No data
931188096_931188101 4 Left 931188096 2:59973284-59973306 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 931188101 2:59973311-59973333 TGAGATGCAGATTACTTAGCTGG No data
931188096_931188102 5 Left 931188096 2:59973284-59973306 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 931188102 2:59973312-59973334 GAGATGCAGATTACTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931188096 Original CRISPR CCTCATCTGTAAAATGGGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr