ID: 931192562

View in Genome Browser
Species Human (GRCh38)
Location 2:60019414-60019436
Sequence CATTTGGAGCAGCATTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931192562_931192567 19 Left 931192562 2:60019414-60019436 CCTGGGGAATGCTGCTCCAAATG No data
Right 931192567 2:60019456-60019478 TATCATTCTTCTCCAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931192562 Original CRISPR CATTTGGAGCAGCATTCCCC AGG (reversed) Intergenic
No off target data available for this crispr