ID: 931193738

View in Genome Browser
Species Human (GRCh38)
Location 2:60029939-60029961
Sequence CCATATCCACACGGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931193738_931193748 20 Left 931193738 2:60029939-60029961 CCCTGCACCCCGTGTGGATATGG No data
Right 931193748 2:60029982-60030004 AACAGAAGGAACAGGCACCATGG No data
931193738_931193745 -7 Left 931193738 2:60029939-60029961 CCCTGCACCCCGTGTGGATATGG No data
Right 931193745 2:60029955-60029977 GATATGGAAGAGGAAAAACAAGG No data
931193738_931193747 12 Left 931193738 2:60029939-60029961 CCCTGCACCCCGTGTGGATATGG No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193738_931193746 6 Left 931193738 2:60029939-60029961 CCCTGCACCCCGTGTGGATATGG No data
Right 931193746 2:60029968-60029990 AAAAACAAGGACAAAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931193738 Original CRISPR CCATATCCACACGGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr