ID: 931193745 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:60029955-60029977 |
Sequence | GATATGGAAGAGGAAAAACA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
931193736_931193745 | 0 | Left | 931193736 | 2:60029932-60029954 | CCACAGTCCCTGCACCCCGTGTG | No data | ||
Right | 931193745 | 2:60029955-60029977 | GATATGGAAGAGGAAAAACAAGG | No data | ||||
931193738_931193745 | -7 | Left | 931193738 | 2:60029939-60029961 | CCCTGCACCCCGTGTGGATATGG | No data | ||
Right | 931193745 | 2:60029955-60029977 | GATATGGAAGAGGAAAAACAAGG | No data | ||||
931193740_931193745 | -8 | Left | 931193740 | 2:60029940-60029962 | CCTGCACCCCGTGTGGATATGGA | No data | ||
Right | 931193745 | 2:60029955-60029977 | GATATGGAAGAGGAAAAACAAGG | No data | ||||
931193735_931193745 | 7 | Left | 931193735 | 2:60029925-60029947 | CCATGAGCCACAGTCCCTGCACC | No data | ||
Right | 931193745 | 2:60029955-60029977 | GATATGGAAGAGGAAAAACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
931193745 | Original CRISPR | GATATGGAAGAGGAAAAACA AGG | Intergenic | ||
No off target data available for this crispr |