ID: 931193745

View in Genome Browser
Species Human (GRCh38)
Location 2:60029955-60029977
Sequence GATATGGAAGAGGAAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931193736_931193745 0 Left 931193736 2:60029932-60029954 CCACAGTCCCTGCACCCCGTGTG No data
Right 931193745 2:60029955-60029977 GATATGGAAGAGGAAAAACAAGG No data
931193738_931193745 -7 Left 931193738 2:60029939-60029961 CCCTGCACCCCGTGTGGATATGG No data
Right 931193745 2:60029955-60029977 GATATGGAAGAGGAAAAACAAGG No data
931193740_931193745 -8 Left 931193740 2:60029940-60029962 CCTGCACCCCGTGTGGATATGGA No data
Right 931193745 2:60029955-60029977 GATATGGAAGAGGAAAAACAAGG No data
931193735_931193745 7 Left 931193735 2:60029925-60029947 CCATGAGCCACAGTCCCTGCACC No data
Right 931193745 2:60029955-60029977 GATATGGAAGAGGAAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931193745 Original CRISPR GATATGGAAGAGGAAAAACA AGG Intergenic
No off target data available for this crispr