ID: 931193747

View in Genome Browser
Species Human (GRCh38)
Location 2:60029974-60029996
Sequence AAGGACAAAACAGAAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931193740_931193747 11 Left 931193740 2:60029940-60029962 CCTGCACCCCGTGTGGATATGGA No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193742_931193747 5 Left 931193742 2:60029946-60029968 CCCCGTGTGGATATGGAAGAGGA No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193736_931193747 19 Left 931193736 2:60029932-60029954 CCACAGTCCCTGCACCCCGTGTG No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193744_931193747 3 Left 931193744 2:60029948-60029970 CCGTGTGGATATGGAAGAGGAAA No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193743_931193747 4 Left 931193743 2:60029947-60029969 CCCGTGTGGATATGGAAGAGGAA No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193738_931193747 12 Left 931193738 2:60029939-60029961 CCCTGCACCCCGTGTGGATATGG No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data
931193735_931193747 26 Left 931193735 2:60029925-60029947 CCATGAGCCACAGTCCCTGCACC No data
Right 931193747 2:60029974-60029996 AAGGACAAAACAGAAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931193747 Original CRISPR AAGGACAAAACAGAAGGAAC AGG Intergenic
No off target data available for this crispr