ID: 931205198

View in Genome Browser
Species Human (GRCh38)
Location 2:60139929-60139951
Sequence GTCCACACCCTGTTTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931205198_931205204 15 Left 931205198 2:60139929-60139951 CCAAGGGAAAACAGGGTGTGGAC No data
Right 931205204 2:60139967-60139989 GGGAAAAGAAATTCCCTGCAGGG No data
931205198_931205200 -6 Left 931205198 2:60139929-60139951 CCAAGGGAAAACAGGGTGTGGAC No data
Right 931205200 2:60139946-60139968 GTGGACCAGCAGAGAGGAGAAGG No data
931205198_931205203 14 Left 931205198 2:60139929-60139951 CCAAGGGAAAACAGGGTGTGGAC No data
Right 931205203 2:60139966-60139988 AGGGAAAAGAAATTCCCTGCAGG No data
931205198_931205201 -5 Left 931205198 2:60139929-60139951 CCAAGGGAAAACAGGGTGTGGAC No data
Right 931205201 2:60139947-60139969 TGGACCAGCAGAGAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931205198 Original CRISPR GTCCACACCCTGTTTTCCCT TGG (reversed) Intergenic
No off target data available for this crispr