ID: 931208921

View in Genome Browser
Species Human (GRCh38)
Location 2:60173963-60173985
Sequence GCACCTTAAAAGTTTTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931208921_931208923 20 Left 931208921 2:60173963-60173985 CCTGGACAAAACTTTTAAGGTGC No data
Right 931208923 2:60174006-60174028 CTCAATGGTCAGATTTCTAAAGG No data
931208921_931208924 24 Left 931208921 2:60173963-60173985 CCTGGACAAAACTTTTAAGGTGC No data
Right 931208924 2:60174010-60174032 ATGGTCAGATTTCTAAAGGTAGG No data
931208921_931208922 5 Left 931208921 2:60173963-60173985 CCTGGACAAAACTTTTAAGGTGC No data
Right 931208922 2:60173991-60174013 TTATTGTCATAATGACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931208921 Original CRISPR GCACCTTAAAAGTTTTGTCC AGG (reversed) Intergenic
No off target data available for this crispr