ID: 931210452

View in Genome Browser
Species Human (GRCh38)
Location 2:60189325-60189347
Sequence GCGTCGTTTTTTAAGCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931210452_931210455 3 Left 931210452 2:60189325-60189347 CCAACAAGCTTAAAAAACGACGC No data
Right 931210455 2:60189351-60189373 AGGAGATTATATCCCGCACCTGG 0: 401
1: 1618
2: 1885
3: 1703
4: 646
931210452_931210457 12 Left 931210452 2:60189325-60189347 CCAACAAGCTTAAAAAACGACGC No data
Right 931210457 2:60189360-60189382 TATCCCGCACCTGGCTCAGAGGG 0: 207
1: 1363
2: 1848
3: 1327
4: 950
931210452_931210461 26 Left 931210452 2:60189325-60189347 CCAACAAGCTTAAAAAACGACGC No data
Right 931210461 2:60189374-60189396 CTCAGAGGGTCCTACGCCCACGG 0: 539
1: 1463
2: 1379
3: 1045
4: 1011
931210452_931210456 11 Left 931210452 2:60189325-60189347 CCAACAAGCTTAAAAAACGACGC No data
Right 931210456 2:60189359-60189381 ATATCCCGCACCTGGCTCAGAGG 0: 202
1: 1377
2: 1844
3: 1349
4: 922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931210452 Original CRISPR GCGTCGTTTTTTAAGCTTGT TGG (reversed) Intergenic
No off target data available for this crispr