ID: 931214090

View in Genome Browser
Species Human (GRCh38)
Location 2:60225578-60225600
Sequence GAGGCTGGTGGGCCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931214090_931214095 -8 Left 931214090 2:60225578-60225600 CCTGCATGTGGCCCACCAGCCTC No data
Right 931214095 2:60225593-60225615 CCAGCCTCTTCTCCAGGCCCTGG No data
931214090_931214102 23 Left 931214090 2:60225578-60225600 CCTGCATGTGGCCCACCAGCCTC No data
Right 931214102 2:60225624-60225646 AGCATCTCACCAGTGGGTGAAGG No data
931214090_931214101 17 Left 931214090 2:60225578-60225600 CCTGCATGTGGCCCACCAGCCTC No data
Right 931214101 2:60225618-60225640 GAGCAGAGCATCTCACCAGTGGG No data
931214090_931214100 16 Left 931214090 2:60225578-60225600 CCTGCATGTGGCCCACCAGCCTC No data
Right 931214100 2:60225617-60225639 AGAGCAGAGCATCTCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931214090 Original CRISPR GAGGCTGGTGGGCCACATGC AGG (reversed) Intergenic
No off target data available for this crispr