ID: 931215909

View in Genome Browser
Species Human (GRCh38)
Location 2:60244459-60244481
Sequence TTCCATGTCATTACTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931215909_931215917 28 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215917 2:60244510-60244532 GTATGGGAATTAGGATTTCTGGG No data
931215909_931215911 5 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215911 2:60244487-60244509 AACTCTCTTTTGTTTAATATAGG No data
931215909_931215914 12 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215914 2:60244494-60244516 TTTTGTTTAATATAGGGTATGGG No data
931215909_931215916 27 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215916 2:60244509-60244531 GGTATGGGAATTAGGATTTCTGG No data
931215909_931215915 19 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215915 2:60244501-60244523 TAATATAGGGTATGGGAATTAGG No data
931215909_931215912 6 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215912 2:60244488-60244510 ACTCTCTTTTGTTTAATATAGGG No data
931215909_931215913 11 Left 931215909 2:60244459-60244481 CCCACTCTAGTAATGACATGGAA No data
Right 931215913 2:60244493-60244515 CTTTTGTTTAATATAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931215909 Original CRISPR TTCCATGTCATTACTAGAGT GGG (reversed) Intergenic
No off target data available for this crispr