ID: 931215920

View in Genome Browser
Species Human (GRCh38)
Location 2:60244561-60244583
Sequence ATATTTTTCCAAAACTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931215920_931215921 10 Left 931215920 2:60244561-60244583 CCTATATAGTTTTGGAAAAATAT No data
Right 931215921 2:60244594-60244616 TAGTTCTTGATAATGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931215920 Original CRISPR ATATTTTTCCAAAACTATAT AGG (reversed) Intergenic
No off target data available for this crispr