ID: 931219469

View in Genome Browser
Species Human (GRCh38)
Location 2:60276319-60276341
Sequence CTATGCTGCTGGAACTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931219469_931219474 -4 Left 931219469 2:60276319-60276341 CCTTGGCAGTTCCAGCAGCATAG No data
Right 931219474 2:60276338-60276360 ATAGTTGTGGGCTCAGGTGCAGG No data
931219469_931219475 8 Left 931219469 2:60276319-60276341 CCTTGGCAGTTCCAGCAGCATAG No data
Right 931219475 2:60276350-60276372 TCAGGTGCAGGCTCTAATCCAGG No data
931219469_931219476 9 Left 931219469 2:60276319-60276341 CCTTGGCAGTTCCAGCAGCATAG No data
Right 931219476 2:60276351-60276373 CAGGTGCAGGCTCTAATCCAGGG No data
931219469_931219473 -10 Left 931219469 2:60276319-60276341 CCTTGGCAGTTCCAGCAGCATAG No data
Right 931219473 2:60276332-60276354 AGCAGCATAGTTGTGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931219469 Original CRISPR CTATGCTGCTGGAACTGCCA AGG (reversed) Intergenic
No off target data available for this crispr