ID: 931221306

View in Genome Browser
Species Human (GRCh38)
Location 2:60290617-60290639
Sequence GGGAACTAAAGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931221301_931221306 -7 Left 931221301 2:60290601-60290623 CCTTTTAATGGGGAGGGGGAACT No data
Right 931221306 2:60290617-60290639 GGGAACTAAAGGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931221306 Original CRISPR GGGAACTAAAGGAAGGTGGG TGG Intergenic
No off target data available for this crispr