ID: 931225381

View in Genome Browser
Species Human (GRCh38)
Location 2:60324815-60324837
Sequence CCCCACCCTGTGCCTTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931225373_931225381 -4 Left 931225373 2:60324796-60324818 CCTCCCCACCTACCTTCCACCCC No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225371_931225381 3 Left 931225371 2:60324789-60324811 CCTGCACCCTCCCCACCTACCTT No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225374_931225381 -7 Left 931225374 2:60324799-60324821 CCCCACCTACCTTCCACCCCACC No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225372_931225381 -3 Left 931225372 2:60324795-60324817 CCCTCCCCACCTACCTTCCACCC No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225367_931225381 27 Left 931225367 2:60324765-60324787 CCGGACTGCATCAGCTCCTGCCT No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225370_931225381 4 Left 931225370 2:60324788-60324810 CCCTGCACCCTCCCCACCTACCT No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225375_931225381 -8 Left 931225375 2:60324800-60324822 CCCACCTACCTTCCACCCCACCC No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225368_931225381 11 Left 931225368 2:60324781-60324803 CCTGCCTCCCTGCACCCTCCCCA No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225376_931225381 -9 Left 931225376 2:60324801-60324823 CCACCTACCTTCCACCCCACCCT No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data
931225369_931225381 7 Left 931225369 2:60324785-60324807 CCTCCCTGCACCCTCCCCACCTA No data
Right 931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931225381 Original CRISPR CCCCACCCTGTGCCTTCCTT AGG Intergenic
No off target data available for this crispr