ID: 931226041

View in Genome Browser
Species Human (GRCh38)
Location 2:60333161-60333183
Sequence CTAGGTAAGAAAATATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931226041_931226044 -2 Left 931226041 2:60333161-60333183 CCAATAAATATTTTCTTACCTAG No data
Right 931226044 2:60333182-60333204 AGGTGAATGACATATTTAATAGG No data
931226041_931226045 12 Left 931226041 2:60333161-60333183 CCAATAAATATTTTCTTACCTAG No data
Right 931226045 2:60333196-60333218 TTTAATAGGTAGAAATCATCAGG No data
931226041_931226046 18 Left 931226041 2:60333161-60333183 CCAATAAATATTTTCTTACCTAG No data
Right 931226046 2:60333202-60333224 AGGTAGAAATCATCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931226041 Original CRISPR CTAGGTAAGAAAATATTTAT TGG (reversed) Intergenic
No off target data available for this crispr