ID: 931229407

View in Genome Browser
Species Human (GRCh38)
Location 2:60361501-60361523
Sequence CTGGGTGAACCCTGGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931229407_931229419 29 Left 931229407 2:60361501-60361523 CCTACAGCCCAGGGTTCACCCAG No data
Right 931229419 2:60361553-60361575 GTTTGAGAAGAAAAGCAACAAGG No data
931229407_931229420 30 Left 931229407 2:60361501-60361523 CCTACAGCCCAGGGTTCACCCAG No data
Right 931229420 2:60361554-60361576 TTTGAGAAGAAAAGCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931229407 Original CRISPR CTGGGTGAACCCTGGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr