ID: 931229941

View in Genome Browser
Species Human (GRCh38)
Location 2:60365652-60365674
Sequence TTGCACAAATAGAACGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931229941_931229943 -7 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229943 2:60365668-60365690 TGTGCAAGTCCTAGTCTTAGAGG No data
931229941_931229950 28 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229950 2:60365703-60365725 AGCTTCCACCCATGAAATGTGGG No data
931229941_931229951 29 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data
931229941_931229944 0 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229944 2:60365675-60365697 GTCCTAGTCTTAGAGGCCACAGG No data
931229941_931229949 27 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229949 2:60365702-60365724 GAGCTTCCACCCATGAAATGTGG No data
931229941_931229945 1 Left 931229941 2:60365652-60365674 CCCGGCTCGTTCTATTTGTGCAA No data
Right 931229945 2:60365676-60365698 TCCTAGTCTTAGAGGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931229941 Original CRISPR TTGCACAAATAGAACGAGCC GGG (reversed) Intergenic
No off target data available for this crispr