ID: 931229946

View in Genome Browser
Species Human (GRCh38)
Location 2:60365677-60365699
Sequence GCCCTGTGGCCTCTAAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931229946_931229949 2 Left 931229946 2:60365677-60365699 CCTAGTCTTAGAGGCCACAGGGC No data
Right 931229949 2:60365702-60365724 GAGCTTCCACCCATGAAATGTGG No data
931229946_931229950 3 Left 931229946 2:60365677-60365699 CCTAGTCTTAGAGGCCACAGGGC No data
Right 931229950 2:60365703-60365725 AGCTTCCACCCATGAAATGTGGG No data
931229946_931229951 4 Left 931229946 2:60365677-60365699 CCTAGTCTTAGAGGCCACAGGGC No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931229946 Original CRISPR GCCCTGTGGCCTCTAAGACT AGG (reversed) Intergenic
No off target data available for this crispr