ID: 931229947

View in Genome Browser
Species Human (GRCh38)
Location 2:60365691-60365713
Sequence GGGTGGAAGCTCAGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931229947_931229951 -10 Left 931229947 2:60365691-60365713 CCACAGGGCCTGAGCTTCCACCC No data
Right 931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931229947 Original CRISPR GGGTGGAAGCTCAGGCCCTG TGG (reversed) Intergenic
No off target data available for this crispr